ID: 1063117040

View in Genome Browser
Species Human (GRCh38)
Location 10:3079031-3079053
Sequence GGGGCAGCCCAGCTACATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063117027_1063117040 -1 Left 1063117027 10:3079009-3079031 CCCTCTCCACCTGTGAAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG No data
1063117029_1063117040 -2 Left 1063117029 10:3079010-3079032 CCTCTCCACCTGTGAAACCCGGG 0: 1
1: 0
2: 2
3: 7
4: 99
Right 1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG No data
1063117033_1063117040 -7 Left 1063117033 10:3079015-3079037 CCACCTGTGAAACCCGGGGGCAG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG No data
1063117034_1063117040 -10 Left 1063117034 10:3079018-3079040 CCTGTGAAACCCGGGGGCAGCCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG No data
1063117026_1063117040 6 Left 1063117026 10:3079002-3079024 CCAGGCTCCCTCTCCACCTGTGA 0: 1
1: 0
2: 5
3: 32
4: 425
Right 1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG No data
1063117025_1063117040 7 Left 1063117025 10:3079001-3079023 CCCAGGCTCCCTCTCCACCTGTG 0: 1
1: 0
2: 11
3: 43
4: 405
Right 1063117040 10:3079031-3079053 GGGGCAGCCCAGCTACATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063117040 Original CRISPR GGGGCAGCCCAGCTACATGG GGG Intronic
No off target data available for this crispr