ID: 1063117546

View in Genome Browser
Species Human (GRCh38)
Location 10:3082523-3082545
Sequence AGGCAGGGGTGAGCGAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 301}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063117546_1063117559 13 Left 1063117546 10:3082523-3082545 CCGGCGCTCGCTCACCCCTGCCT 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1063117559 10:3082559-3082581 CACAGCCGAAGAGGTGGGCAGGG 0: 1
1: 0
2: 4
3: 25
4: 207
1063117546_1063117555 4 Left 1063117546 10:3082523-3082545 CCGGCGCTCGCTCACCCCTGCCT 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1063117555 10:3082550-3082572 CATGCTGAGCACAGCCGAAGAGG 0: 1
1: 0
2: 0
3: 7
4: 126
1063117546_1063117556 7 Left 1063117546 10:3082523-3082545 CCGGCGCTCGCTCACCCCTGCCT 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1063117556 10:3082553-3082575 GCTGAGCACAGCCGAAGAGGTGG 0: 1
1: 0
2: 0
3: 16
4: 186
1063117546_1063117557 8 Left 1063117546 10:3082523-3082545 CCGGCGCTCGCTCACCCCTGCCT 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1063117557 10:3082554-3082576 CTGAGCACAGCCGAAGAGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 169
1063117546_1063117558 12 Left 1063117546 10:3082523-3082545 CCGGCGCTCGCTCACCCCTGCCT 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1063117558 10:3082558-3082580 GCACAGCCGAAGAGGTGGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 172
1063117546_1063117560 14 Left 1063117546 10:3082523-3082545 CCGGCGCTCGCTCACCCCTGCCT 0: 1
1: 0
2: 1
3: 25
4: 301
Right 1063117560 10:3082560-3082582 ACAGCCGAAGAGGTGGGCAGGGG 0: 1
1: 0
2: 4
3: 35
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063117546 Original CRISPR AGGCAGGGGTGAGCGAGCGC CGG (reversed) Intronic
900227525 1:1540118-1540140 AGGCCGGGGTGGGGGAGCGCAGG + Intronic
900237408 1:1599351-1599373 AGGCCGGGGCGCGCGAGGGCCGG + Exonic
900551509 1:3258783-3258805 GGGAAGGGGTGAGCGCGCGGCGG + Intronic
902724144 1:18323993-18324015 AGGCAGGGATGGGGCAGCGCTGG - Intronic
902845446 1:19106779-19106801 AGGCAGGGCTGTCAGAGCGCAGG + Intronic
903018159 1:20375333-20375355 AGACAGGGCTGAGAGAGCACAGG - Intergenic
903191565 1:21659413-21659435 AGGGAGGGGTGAGGAAGTGCGGG - Intronic
903336501 1:22627814-22627836 AGGGAGGGGTGAGGGTGCGAGGG - Intergenic
903679691 1:25088679-25088701 GGGCAGGGGTGAGAGGGGGCTGG + Intergenic
903731711 1:25501437-25501459 AGGCAGGGGAGAGGGATGGCAGG - Intergenic
903860241 1:26360452-26360474 AGGCGGGGCTGAGCGAGCGAGGG + Intergenic
903928974 1:26851282-26851304 AGGCAGGGCTGAGGGAGCCTGGG + Intronic
904498451 1:30900800-30900822 AGGCAGGGATGGGGGAGGGCAGG + Intronic
904629670 1:31831460-31831482 TGGCAGGGGTGAGTGAGGGAGGG - Intergenic
905732931 1:40308456-40308478 AGGCTGGGCTGAGCCAGAGCAGG + Intronic
906365581 1:45206602-45206624 AGACAGGCGGGAGCGAGCGCGGG + Intronic
907264330 1:53247563-53247585 AAGCAGGGGTGAGGGAGAGAGGG - Intronic
907305824 1:53512678-53512700 AGGCAGGGGTGGGCAGGCGGGGG + Intronic
907328238 1:53654675-53654697 AGGGAGGAGGGAGCGAGCCCTGG + Intronic
908153747 1:61330785-61330807 AGGTAGGGATGAGCAAGAGCTGG + Intronic
908250116 1:62259028-62259050 AGGCAGGTGGGAGCCAGGGCAGG + Intronic
908473882 1:64470413-64470435 AGGCCGGGGTGCGCGGGCCCCGG - Intergenic
908565181 1:65346904-65346926 AGGCAGGGGTGGTGGAGCGGGGG - Intronic
912203088 1:107480571-107480593 AGGTAGGGGTGGGTGGGCGCGGG - Intronic
913178084 1:116293261-116293283 GGGCAGAGGTGAGCGCGCACAGG + Intergenic
914899203 1:151703032-151703054 AGGCTGGGGTGAGGGTGAGCTGG + Exonic
915280595 1:154819736-154819758 AGGCAGGGCTGGGCCAGAGCAGG + Intronic
915292558 1:154896463-154896485 AGGCAGGGGTGACCGGCCCCAGG + Intergenic
915769337 1:158403259-158403281 AGGCAGGGGTTGGTGAGTGCTGG + Intergenic
918732372 1:188013801-188013823 AGGCAGAGGAGAGCGAGCGAGGG + Intergenic
919727063 1:200891380-200891402 CCGCAGGGGTGAGCGAGCTGCGG - Intronic
920315769 1:205074742-205074764 AGGCAGGAGTGAGTCAGTGCTGG - Exonic
920371241 1:205480747-205480769 AGGCAGCGGTGGGAGAGGGCAGG + Intergenic
921326127 1:213987734-213987756 AGGCCGGGGAGGGGGAGCGCAGG + Intronic
921491860 1:215786885-215786907 TGGCAGGGGTGAGAGAGAGAGGG + Intronic
921737280 1:218642776-218642798 AGGCAGGGTTGAGGGAAAGCCGG + Intergenic
922050355 1:221983471-221983493 AGGCAGAGGGGAGGGAGGGCTGG - Intergenic
923819640 1:237423969-237423991 AGGCAGGTGAGAGAGAGAGCAGG + Intronic
924227211 1:241932075-241932097 AGGCTTGGGTAAGCCAGCGCAGG + Intergenic
1062914482 10:1236336-1236358 AGGCAGGGGGGAGTGAACACCGG - Intronic
1062914842 10:1237525-1237547 AGGCAGGGGGGAGTGAACACCGG - Intronic
1063101991 10:2958396-2958418 AGGCAGTGGTGAGGGGGTGCAGG - Intergenic
1063117546 10:3082523-3082545 AGGCAGGGGTGAGCGAGCGCCGG - Intronic
1065133325 10:22644121-22644143 AGGGAGGGGTGAGCAGGAGCTGG - Intronic
1066255929 10:33678911-33678933 AGGCAAGAGAGAGAGAGCGCGGG + Intergenic
1066585747 10:36932877-36932899 AGGAAGAGGTGAGCTAGCACAGG + Intergenic
1067392256 10:45874538-45874560 GGGCAGTGGTGAGGGAGCCCAGG + Intergenic
1067402674 10:45991890-45991912 GGGCAGTGGTGAGGGAGCCCAGG - Intronic
1067415384 10:46098138-46098160 AGGCAGGGCAGAGAGAGGGCAGG + Intergenic
1067435427 10:46273215-46273237 AGGCAGGGTAGAGGGAGGGCAGG + Intergenic
1067574860 10:47402767-47402789 AGGCAGGGCTGGGAGAGGGCTGG + Intergenic
1067582225 10:47452905-47452927 AGGCAGGGCAGAGGGAGGGCAGG + Intergenic
1067871030 10:49961524-49961546 GGGCAGTGGTGAGGGAGCCCAGG - Intronic
1069867765 10:71514271-71514293 AGGCTGGGGAGAGCCAGCCCAGG + Intronic
1069962457 10:72087155-72087177 AAGCAGGGGTGAGGCAGGGCGGG - Intronic
1070768224 10:79068445-79068467 AGGCGGGGGCGTGCCAGCGCGGG + Intergenic
1070895764 10:79982108-79982130 AGGAGGGCGGGAGCGAGCGCGGG - Intronic
1071814441 10:89218619-89218641 AGGCAGGGGAGAGGGAGCTCAGG - Intronic
1076297476 10:129397734-129397756 AGGCCGGGGTGACCCAGTGCAGG - Intergenic
1076452249 10:130564909-130564931 AGGCAGGGAGGAGCCAGTGCAGG - Intergenic
1076621861 10:131794077-131794099 AGGAAGGGGTGACCGAGCTCAGG + Intergenic
1076676459 10:132149761-132149783 GGGCAGGGGTGAGGTAGGGCGGG - Intronic
1076676485 10:132149815-132149837 GGGCAGGGGTGAGGTAGGGCGGG - Intronic
1076676498 10:132149842-132149864 GGGCAGGGGTGAGGTAGGGCAGG - Intronic
1077097186 11:804042-804064 AGGCAGGGCAGAGCGAGAGATGG + Intronic
1077218704 11:1405796-1405818 AGGCAGGAAGGACCGAGCGCTGG - Intronic
1077324679 11:1958647-1958669 AGGCCGGGGTGAGACAGGGCGGG - Intronic
1077385982 11:2269698-2269720 AGGCAGGGAGGAGGGAGGGCCGG - Intronic
1077609519 11:3635873-3635895 AGGAAGGGGTGGGCGAGGGCTGG - Intergenic
1077650555 11:3967890-3967912 AGGCAGGGGGCAGCCAGCCCAGG - Intronic
1078766656 11:14304788-14304810 AGGCAGCTGTGAGCCAGAGCTGG + Intronic
1082783701 11:57304931-57304953 AGGCAGAGGTCAGTGAGCTCTGG + Intronic
1083722881 11:64612064-64612086 AGGCCGGGTTGAGTGAGCCCAGG - Intronic
1084751109 11:71204935-71204957 AGGCAGGGGACAGCTAGCTCGGG + Intronic
1084980202 11:72824871-72824893 GGGCAGTGGTGAGAGAGTGCAGG + Intronic
1085758502 11:79221603-79221625 AGGCAGGGGTGAGCACGCACAGG - Intronic
1088558008 11:111082664-111082686 AGGCAAGGGAGAGTGAGGGCTGG + Intergenic
1089418798 11:118315685-118315707 AGGCAGGGAGGAGGGAGCGGGGG - Exonic
1089457904 11:118635982-118636004 AGGCAGGGCTGAGCCATGGCTGG - Intronic
1090252899 11:125263737-125263759 AGGCCAGGGAGAGCCAGCGCCGG - Intronic
1090416164 11:126541959-126541981 AGGCAGAGCTGAGGCAGCGCGGG + Intronic
1090446993 11:126772956-126772978 AGGTAGGGGTGAGCAAGCTATGG + Intronic
1202807658 11_KI270721v1_random:13824-13846 AGGCCGGGGTGAGACAGGGCGGG - Intergenic
1091697117 12:2635171-2635193 AGGCAGGGGTGTGAGAGGTCAGG - Intronic
1092221953 12:6720073-6720095 AGGCAAGGTAGAGCGAGAGCAGG - Intergenic
1094441332 12:30480356-30480378 AGGCAAGAGTGAGCAAGAGCAGG - Intergenic
1094498786 12:31005635-31005657 AGGCAGGGGTGGGTGGGCGCAGG + Intergenic
1095735575 12:45552974-45552996 AGGCAGGAGTGAGGGAGCCAGGG - Intergenic
1097176864 12:57148434-57148456 AGGTGGGGGTGAGAGTGCGCAGG - Intronic
1097183384 12:57183675-57183697 AGACAGAGGTGAGAGAGTGCCGG - Intronic
1102012327 12:109626388-109626410 AGGGAGGGGTGGGGGAGCACTGG - Intergenic
1102527101 12:113519990-113520012 AGGCAGGGGTGGGGGGGCGGAGG + Intergenic
1103594986 12:122019604-122019626 AGGCAAGGGGGAGGGAGAGCAGG - Exonic
1103724012 12:122989022-122989044 AGGCAAGCGGGAGGGAGCGCAGG + Intronic
1103852407 12:123941685-123941707 GCGCAGGGCTGAGCGAGCCCTGG + Intronic
1103902193 12:124309090-124309112 AGGCAGGGCTGAGGGCGTGCGGG + Intronic
1104860848 12:131922620-131922642 AGGCAGGGCTAATCGAGGGCTGG - Exonic
1105474424 13:20718467-20718489 GGGCAGGTGTGAGCGTGGGCAGG - Intronic
1105474490 13:20718793-20718815 GGGCAGGGGTGAGCGTGGGCAGG - Intronic
1105474518 13:20718929-20718951 AGGCAGGTGTGAGCGTGGGCAGG - Intronic
1105590727 13:21790712-21790734 AAGGAGGGGTGAGCCAGCCCAGG + Intergenic
1106231828 13:27826576-27826598 AGGCAGGGGTGAGTGGGCCGAGG + Intergenic
1107905566 13:45058032-45058054 GGGCAGGGGTGAGGGCACGCTGG - Intergenic
1109512464 13:63396984-63397006 AGGGATGTGTGAGCGAGCACGGG - Intergenic
1112801026 13:103109930-103109952 AGGGTGGGGTGAGGGAGAGCAGG - Intergenic
1113692337 13:112319728-112319750 AGGCAGAGGTGAGCGAGCCAGGG + Intergenic
1113811102 13:113143177-113143199 AGGCAGGGGTGTGGGGGAGCAGG - Intronic
1113975886 13:114226971-114226993 TGGCAGGTGTGAGCCACCGCCGG - Intergenic
1115484945 14:33901525-33901547 AGCCAGGTGTGAGCAAGCTCAGG + Intergenic
1117586098 14:57207017-57207039 AGCCAAGGGAGAGCCAGCGCAGG - Exonic
1119423546 14:74522154-74522176 AGGAAGGGGTGAGGGAGTGGAGG + Intronic
1121023017 14:90593271-90593293 AGGCAGGGGAGAGGGATCGGGGG + Intronic
1121617018 14:95319994-95320016 GGGCTGGCGCGAGCGAGCGCGGG + Intergenic
1121880503 14:97496482-97496504 AGGGAGGGGTGAGAGATGGCAGG + Intergenic
1122659756 14:103287454-103287476 AGGCAGGGGTGAGGCAGCCCTGG + Intergenic
1122877277 14:104674069-104674091 TGGCAGGAGAGAGAGAGCGCAGG - Intergenic
1125343976 15:38700415-38700437 AGGCAGGAGGGAGAGAGGGCAGG + Intergenic
1126196589 15:45938251-45938273 AGGCAGGGGTCAGCGGCTGCAGG + Intergenic
1126843165 15:52736543-52736565 AGGCAGGGGAGAGCCAGCAAGGG - Intergenic
1128380004 15:67105496-67105518 AGGCAGGGCTGAGCTTGGGCAGG + Intronic
1128743587 15:70098994-70099016 GGGCCGGGGCGAGCGAGCGGGGG - Intergenic
1128761705 15:70220672-70220694 AGGCAGGAGGGAGAGAGCACTGG - Intergenic
1129676133 15:77633115-77633137 AGGCAGGGGTGCGCAGGCGAGGG + Intronic
1129708471 15:77808083-77808105 GGGAAGGGGTGAGCGAGCAGGGG - Intronic
1130957688 15:88639071-88639093 AGGCAGGTGAGAGCGGGAGCTGG + Exonic
1131918922 15:97301823-97301845 AGGCAGGGGTGGTTGAGCACTGG + Intergenic
1131919131 15:97303582-97303604 AGGCAGGGGTGCTTGAGCACTGG - Intergenic
1132198021 15:99928455-99928477 AGGGCGGGGTGCGCGAGCGAGGG + Intergenic
1132255730 15:100374026-100374048 GGGTAAGGGTGAGCGAGGGCAGG - Intergenic
1132385371 15:101396682-101396704 AGGCTGGGCTGAGTGAGTGCTGG - Intronic
1132933945 16:2471771-2471793 TGGCAGGGGTCGGCGGGCGCCGG - Exonic
1132984377 16:2756599-2756621 GAGCAGGGGTGAGGGAGAGCTGG + Exonic
1133835060 16:9360455-9360477 AAGCAAGGGTGAGCAAGGGCTGG + Intergenic
1136022833 16:27450845-27450867 AAGCATGGGTGAGCTAGAGCTGG - Exonic
1136115419 16:28091441-28091463 AGGTAGAGCTGAGCCAGCGCTGG + Intergenic
1136118066 16:28108357-28108379 AGGCAGAGGTCAGAGAGCCCTGG + Intronic
1136399694 16:30010726-30010748 GGGCTGTGGTGAGCGAGCGGGGG - Intronic
1137931358 16:52590562-52590584 AGACAGGGTTGACCCAGCGCTGG + Intergenic
1139545890 16:67649393-67649415 AGTCAGGGGTCAGTGAGGGCAGG - Intronic
1140978281 16:80081987-80082009 AGGGAGGAGTGAGGGAGGGCAGG - Intergenic
1141106103 16:81235064-81235086 AGGCCAGGGTGAGCCAGTGCAGG + Intergenic
1141591402 16:85071477-85071499 AGGCAGGGGTCAGGAGGCGCAGG + Intronic
1142126103 16:88411446-88411468 AGGCAGGGGTGCGAGTGGGCAGG + Intergenic
1142126112 16:88411478-88411500 AGGCAGGGGTGCGAGCGGGCAGG + Intergenic
1142126121 16:88411510-88411532 AGGCAGGGGTGCGAGCGGGCAGG + Intergenic
1142188305 16:88705352-88705374 TGGCAGGGGAGAGAGAGAGCAGG - Intronic
1142283046 16:89159506-89159528 AGTGTGGGGTGAGCGTGCGCTGG - Intergenic
1142559229 17:800139-800161 TGGCAGGGGTGATCGAACGTGGG + Exonic
1143287025 17:5797766-5797788 AGGCAGGGGTGAGAGAAAGGGGG + Intronic
1145094055 17:20009492-20009514 AGGGATGGGCGGGCGAGCGCGGG + Intronic
1145272334 17:21411392-21411414 AGGCAGTGGGGAGAGAGCACGGG - Intronic
1145310540 17:21698857-21698879 AGGCAGTGGGGAGAGAGCGCGGG - Intronic
1146591479 17:34131550-34131572 AGGCAGGGGTAAGTCAGGGCTGG - Intronic
1147792418 17:43021862-43021884 GGGCACGAGTGGGCGAGCGCCGG - Intronic
1148206761 17:45784344-45784366 GGGAAGGGGCGAGCGAGAGCCGG + Intronic
1148610985 17:48964462-48964484 AGGCAGGGAGGGGAGAGCGCTGG + Exonic
1148746284 17:49920135-49920157 AGGCAGGGGTGAGAGGGAGGGGG - Intergenic
1150608380 17:66713683-66713705 AGAGAGGTGTGAGCGAGCGGTGG - Intronic
1154216502 18:12420287-12420309 AGGCGGCGGTGAGCAAGCGCCGG - Intronic
1157496952 18:48162946-48162968 AGGAAGGGCTGAGGGAGGGCAGG + Intronic
1158579667 18:58671049-58671071 AGTCAGGGGAGAGCGCTCGCCGG + Intergenic
1160517265 18:79485495-79485517 AGGCTGGGGTGGGCGTGGGCTGG + Intronic
1160686466 19:439092-439114 AGGAAGGGGTCAGAGAGGGCGGG + Intronic
1160731025 19:641868-641890 AGGCCGGGGTGAGCGAGTGTGGG + Intronic
1160747751 19:719852-719874 CCGCAGGAGGGAGCGAGCGCTGG + Intronic
1161089074 19:2351318-2351340 GGGCAGGGGTGTGCGAGGACGGG - Intronic
1162019817 19:7863273-7863295 AGGCCGAGGTGAGCCGGCGCGGG + Exonic
1162372918 19:10289796-10289818 TGGCAGGAGTGAGCGACCCCTGG - Intergenic
1162534080 19:11253018-11253040 AGGCAGGGGTGGGTGCGCGCTGG + Intronic
1163183433 19:15619678-15619700 AGGCAGGCGTCAGCAAGCGACGG - Exonic
1163263853 19:16206678-16206700 AAGCAGGGGTCAGCGAGCTTTGG + Intronic
1163545996 19:17941889-17941911 AGGCAGGGGTGTCCGAGACCAGG + Intronic
1163604671 19:18267412-18267434 AGACTGGGGTGAGCGGGGGCTGG + Exonic
1164532446 19:29058655-29058677 AGGCAGGGGTCAGCAGGTGCTGG + Intergenic
1165490896 19:36122037-36122059 AGGCAGGAGTGAGGGAACACAGG + Intronic
1165898011 19:39155039-39155061 GGGCAGGGGTGTGCCAGAGCAGG + Intronic
1165903448 19:39179345-39179367 AGGCAGGGGTGGGCGGGCTGGGG - Exonic
1165958089 19:39514761-39514783 GGGCAGGGATGAGGGAGCCCAGG - Intergenic
925588051 2:5483067-5483089 AGGCAGGGGTGAGGGTGTGCAGG + Intergenic
927720637 2:25379712-25379734 AGCCTCGGGTGAGCAAGCGCAGG - Intronic
929157941 2:38804613-38804635 AGGCAGGGGTGGGGTAGGGCTGG - Intronic
930664252 2:54086371-54086393 AGGCAGGGGAGAGTGAGCTGTGG + Intronic
932214898 2:69960448-69960470 AGGCACAGGTGAGGGAGAGCAGG - Exonic
932549403 2:72752586-72752608 AGGCAGGGGTGAGGGAGGGAGGG - Intronic
932667428 2:73708483-73708505 AGCCAGGGGTGGGGGAGCACAGG - Intergenic
933844189 2:86312126-86312148 AGGCAGGGGTGAGCTGGTGAGGG - Intronic
934047661 2:88185904-88185926 AGGCAGGGGCGAGGCAGCACCGG - Exonic
934766389 2:96882423-96882445 AGGCAGGGGTGGGCGAGTGAGGG + Intronic
936164366 2:110107060-110107082 AGGAGGGGGTGAGGGAGGGCAGG + Intronic
937982143 2:127622110-127622132 TGGCAGGGGTGAGAGCGGGCAGG + Intronic
939900424 2:147844314-147844336 GGGGAGGGGTGAGAGAGCGAGGG - Intergenic
941917854 2:170823771-170823793 AGGCAGAACTGAGCGAGCCCTGG + Intronic
944675929 2:202034193-202034215 CGGCCGGGGCGAGCGAGCGGCGG + Intergenic
946202183 2:218076791-218076813 AGGCAGGGGTGAGGGTGGGAAGG - Intronic
948206908 2:236167384-236167406 AGGCGGGGGCGGGCCAGCGCCGG - Intronic
948376548 2:237524838-237524860 AGGCAGTGCTGAGCCAGAGCTGG + Intronic
948516329 2:238505997-238506019 AGGCAGGGGTCAGGCAGCTCAGG + Intergenic
948677626 2:239608075-239608097 AGGCTGGCGTGAGGGAGTGCTGG + Intergenic
948855267 2:240727391-240727413 AGGCTGGGGTGGGCCCGCGCAGG - Intronic
1168769714 20:407812-407834 AGGCTTGGGTGAGCAGGCGCCGG + Intronic
1169801248 20:9514749-9514771 GGGCCGGGGTGAGCGAGAGGCGG - Exonic
1172836948 20:37879206-37879228 AGGCAGGGCTGAGGGTGGGCGGG - Intergenic
1173866420 20:46315337-46315359 AGGCAGAGGTGAGCTGGCTCTGG - Intergenic
1174901970 20:54509804-54509826 AGGCAGGGGTCAGTGTGAGCAGG - Intronic
1175999144 20:62824367-62824389 ACGCAGGGGTCAGCGCCCGCGGG - Intronic
1176195836 20:63836054-63836076 GGGCAGGGGAGAGCGCGGGCAGG + Intergenic
1176195903 20:63836239-63836261 GGGCAGGGGAGAGCGTGGGCAGG + Intergenic
1176388362 21:6150988-6151010 AGGCAGGCCTGGGCGAGCCCTGG + Intergenic
1178670143 21:34582832-34582854 AGACAGGGGTGAGAGAGGGAGGG + Intronic
1179735110 21:43387260-43387282 AGGCAGGCCTGGGCGAGCCCTGG - Intergenic
1179825894 21:43966353-43966375 TGCCAGGGGTGAGCCAGCGGTGG + Intronic
1179899313 21:44380793-44380815 AGGCAAGGCTGAGCGAGGGTGGG - Intronic
1179994068 21:44965924-44965946 AGGCAGGGTGGAGTAAGCGCTGG + Intronic
1180190511 21:46160588-46160610 TGCCGGGGGTGGGCGAGCGCCGG - Intergenic
1180190546 21:46160677-46160699 TGCCGGGGGTGGGCGAGCGCCGG - Intergenic
1180577382 22:16791701-16791723 AGGCAGGGGGGAGAGAGAGAGGG + Intronic
1181038940 22:20182900-20182922 AGGCAGGGGTGGGAGGGCCCTGG + Intergenic
1182132216 22:27863314-27863336 AAGCAGGGGTGAGCGAACTAAGG + Intronic
1182348962 22:29687760-29687782 AGGCAGGGGTGAGAGGGGGAAGG + Intronic
1183650014 22:39148464-39148486 AGGCAGGGGTGTGCGCGCCCAGG + Intronic
1183987125 22:41575976-41575998 AGGCAGGGGTGAGGGTGGCCTGG + Exonic
1184410655 22:44324286-44324308 AGGCAGGGGGGAGCCAGCTTTGG - Intergenic
1184523187 22:45007689-45007711 AGGGGCGGGTGTGCGAGCGCGGG + Intronic
950541522 3:13616056-13616078 AGGCAGGGGTGAGTGTGTGGGGG + Intronic
950670117 3:14520942-14520964 AGACATGGGTGGGCGAGGGCAGG - Intronic
952316781 3:32238715-32238737 AGGAAGAGGAGAGCGAGCGAGGG - Exonic
953879826 3:46685890-46685912 AGGCAGGGGTGGCCGAGTACTGG - Intronic
954398005 3:50303221-50303243 AAGCAGGGGTGGGCGAGCTTAGG - Exonic
954578052 3:51687635-51687657 TGGCAGGGGTGAGAGAGGCCAGG + Intronic
955463149 3:59207858-59207880 AGGCAGAGGTGAAGGAGCGATGG - Intergenic
955751038 3:62185642-62185664 TGGCAGTGGTGAGCTAGAGCAGG - Intronic
957210161 3:77248605-77248627 GGGCGCAGGTGAGCGAGCGCAGG - Intronic
961634013 3:128321628-128321650 AGGCAGGGGAAAGCCAGTGCAGG - Intronic
962205249 3:133428804-133428826 AGGCAGGTCAGAGCGAGGGCAGG - Intronic
966240591 3:177751677-177751699 GGGCAGGGCTGAGAGAGGGCAGG + Intergenic
966942454 3:184755641-184755663 AGGCAAGGATGAGCCAGCCCTGG - Intergenic
968232956 3:197015161-197015183 AGGCGGGGAGGAGCGACCGCAGG - Intronic
968563179 4:1295743-1295765 AGGCACGGGTGAGGGGGCACAGG - Intronic
968570541 4:1338195-1338217 AGGCCGGGGTGAGAAGGCGCAGG + Intronic
968585347 4:1413789-1413811 GGGCAGGGATGAGCGCGCTCAGG + Intergenic
968660016 4:1794983-1795005 GGGGAGGTGTGAGCGACCGCGGG + Intronic
968797066 4:2714182-2714204 AAGCAAGGGTGAGAGAGGGCCGG - Intronic
969299989 4:6292085-6292107 AGGCACGGGTGAGATAGGGCAGG - Intronic
969657719 4:8507772-8507794 GGGCAGGGGTGAAGGAGCGGGGG - Intergenic
971177122 4:24292599-24292621 AGGCAGGGGTGAGGGTGAGGGGG - Intergenic
972333281 4:38082727-38082749 AGGCCTGGGTGGGCGAGCCCAGG - Intronic
974016804 4:56655816-56655838 AGGCAGGGGTCGGGGCGCGCTGG + Intronic
974515092 4:62897933-62897955 TGGCAGGGCTGAGCCAGCCCAGG + Intergenic
981291658 4:143083383-143083405 AAGCAGGGGTGAGAAAGCACTGG + Intergenic
982248670 4:153381830-153381852 AAGCAGGGGTGAACCAGCCCTGG - Intronic
982348570 4:154389002-154389024 AACCAGGGGTGAGCAAGGGCCGG + Intronic
984639291 4:182144606-182144628 AGGGAGCGGGGAGCGGGCGCCGG - Intronic
985769560 5:1800322-1800344 AGGCAGGGATAAGCGAGCTAAGG - Intronic
985840543 5:2301988-2302010 AGGCAGGGGTGAGCAAGCACAGG - Intergenic
985948680 5:3206246-3206268 AGACAGGGCTGAGAGAGCACTGG - Intergenic
986156054 5:5177045-5177067 AGGCAAGGGTGAGGCAGGGCTGG - Intronic
995724125 5:115166957-115166979 GTGCATGAGTGAGCGAGCGCGGG - Intronic
1000703417 5:164481184-164481206 AGGCAGGAGAGAGCGTGTGCAGG + Intergenic
1002425420 5:179171943-179171965 AGGCAGGGGAGAGGCAGTGCTGG - Intronic
1002454792 5:179339803-179339825 AGGCAGGTGTGAGCGGGTCCTGG - Intronic
1002828126 6:792280-792302 AGGCCGGGGTGAGCCAGAACTGG + Intergenic
1003176073 6:3752618-3752640 AGGCAGGGGTGGGAGAGCCAGGG + Intergenic
1004665469 6:17745297-17745319 AGGCTGAGGAGTGCGAGCGCAGG - Intergenic
1006428056 6:33978453-33978475 AGGCAGGGGAGAGGGAGTGGAGG + Intergenic
1006534272 6:34685448-34685470 AGGAGGGGGTGAGCCAGCCCAGG - Intronic
1008600685 6:53091134-53091156 AGGGAGGGGTGAACTAGCCCAGG + Intronic
1012582462 6:100885248-100885270 AGGCAGGGGTGAAAAAGGGCAGG - Intergenic
1016714129 6:147204181-147204203 AGGCTGGGCTGAGCGGGCTCGGG + Intergenic
1018795565 6:167182669-167182691 AGGCAGAGGTGGGTGACCGCTGG - Exonic
1018820754 6:167372394-167372416 AGGCAGAGGTGGGTGACCGCTGG + Exonic
1018823538 6:167392834-167392856 AGGCACAGGTGAGGAAGCGCAGG - Intergenic
1018823617 6:167393123-167393145 AGGCACAGGTGAGGGGGCGCAGG - Intergenic
1019305464 7:332516-332538 GGGCAGGGGTGAGCGGGCTGGGG + Intergenic
1019403814 7:872015-872037 AGGCAGAAGGGAGCGAGTGCCGG - Intronic
1019421464 7:953161-953183 AGTCTGGGGTGAGCCAGCCCAGG + Intronic
1019423643 7:963154-963176 AGGCAGGTGTCAGCGGGGGCAGG + Intronic
1019475560 7:1242481-1242503 GGGCTGCGGGGAGCGAGCGCGGG + Intergenic
1019617452 7:1971874-1971896 AAGCAGGGAGGAGGGAGCGCTGG + Intronic
1019666040 7:2252756-2252778 GGGCAGGGGTGAGGGGGAGCAGG - Exonic
1019666081 7:2252886-2252908 GGGCAGGGGTGAGAGAGCAAGGG - Exonic
1019918734 7:4149735-4149757 AGGCAGGGGTGATGGGGGGCAGG + Intronic
1021973795 7:25991358-25991380 TGGCAGGAGAGAGCGAGCTCAGG - Intergenic
1027737823 7:81956668-81956690 AGGCAGGGGTGATAGAGGGTGGG - Intronic
1028271930 7:88802098-88802120 AGGCGGGAGGGAGCGAGCACAGG - Intronic
1028417672 7:90596746-90596768 AGGCCGAGGGGAGCGGGCGCTGG - Intronic
1029271567 7:99380136-99380158 AGGCGGGGGTGAGCACACGCTGG + Intronic
1029640557 7:101816818-101816840 CGGCCGGGGGTAGCGAGCGCGGG - Intronic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1030796287 7:113791885-113791907 ATGTAGAGGTGAGCGTGCGCAGG + Intergenic
1030876939 7:114825491-114825513 TGGCAGGAGAGAGAGAGCGCAGG + Intergenic
1033662180 7:143409515-143409537 AGGCAGGTGTGGGCCAGGGCTGG + Intergenic
1033798363 7:144873663-144873685 AGGCCAGCGTGAGCAAGCGCAGG - Intergenic
1035358463 7:158294616-158294638 AGGCAGGGCTGAGCCAGGCCAGG + Intronic
1036794758 8:11747381-11747403 GGGGAGGGGTGAGCGAGTGAAGG + Intronic
1040306219 8:46213215-46213237 AGGGTGGCGTGGGCGAGCGCAGG + Intergenic
1045215665 8:100145952-100145974 GTGCAGGGGTGAGCGAGAGAGGG - Intergenic
1045674092 8:104589063-104589085 AGGGAGGAGGGAGCGCGCGCGGG - Intergenic
1046050016 8:109011697-109011719 AGGCAAGGAGGAGCAAGCGCAGG - Intergenic
1046384538 8:113491898-113491920 GGGCTGGGGTGAGTTAGCGCAGG - Intergenic
1047752575 8:127892886-127892908 AGGAAGGGGTGAGAGAGGACTGG - Intergenic
1048321513 8:133404036-133404058 TGGCAGGGGTGAGCAACTGCAGG - Intergenic
1049150990 8:141035449-141035471 AGGCAGTGGGGAGCGAGGGCAGG - Intergenic
1049244394 8:141554145-141554167 AGGGAGAGGTGAGGGAGCTCAGG + Intergenic
1049282867 8:141759412-141759434 GGGCAGGGGTGAGCGGGGGCAGG + Intergenic
1049313771 8:141947992-141948014 AGTTAGGGGTGAGCCAGCTCAGG + Intergenic
1049502678 8:142975717-142975739 GCGCAGGGGAGAGAGAGCGCAGG + Intergenic
1049543823 8:143220472-143220494 AGGCAGGGCTGAGGGAGAGTTGG - Intergenic
1049706218 8:144044061-144044083 AGTCAGGAGTGAGTGAGTGCAGG - Intronic
1050361930 9:4838361-4838383 AGGCAGGGGTGAGAAAGAGTGGG - Intronic
1051637486 9:19194232-19194254 CGGCAGGAGAGAGTGAGCGCAGG + Intergenic
1053213440 9:36251315-36251337 AGGGAGGGATGAGCGAGCAGTGG - Intronic
1056768926 9:89462948-89462970 AAGGAGGGGGGAGCGAGCGAGGG + Intronic
1060730409 9:126033511-126033533 AGGCCAGGGTGAGCAAGCCCAGG - Intergenic
1061059869 9:128244990-128245012 TGGCAGGGGTGAGCGGGAGCTGG + Intronic
1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG + Intergenic
1061588301 9:131582729-131582751 GGACAGGGGTGAGCGAGTGCTGG + Intronic
1061875981 9:133544261-133544283 AGGAAGGGGTGAGCCTGGGCAGG + Intronic
1062033315 9:134371787-134371809 AGCCATGGGTGCGCGAGTGCAGG + Intronic
1062081239 9:134624813-134624835 AGGCTGGGGCAAGCGAGAGCAGG - Intergenic
1062192661 9:135255856-135255878 AGGCTGGGGTGTGCGGGGGCAGG - Intergenic
1062443056 9:136579633-136579655 AGGTAGGGGTGAGGGAGGGGAGG - Intergenic
1195706631 X:107742346-107742368 AGGAAGGGGGGAGGGAGCGGGGG + Intronic
1196016290 X:110944161-110944183 GGGCTGGGGGGAGCGAGGGCGGG - Intergenic
1196207211 X:112954608-112954630 AGGAAGGAGTGAGGGAGGGCAGG - Intergenic
1198518180 X:137428698-137428720 CGGCAAGGGTGGGCCAGCGCCGG - Intergenic
1199860536 X:151797135-151797157 AGGTAGGGGGGAGGGAGTGCTGG - Intergenic
1200068705 X:153517568-153517590 AGGGAGGAGGGAGCGGGCGCGGG - Intergenic
1200093975 X:153648650-153648672 AGGCAGGGGTCAGACAGCACTGG + Intronic