ID: 1063123710

View in Genome Browser
Species Human (GRCh38)
Location 10:3122731-3122753
Sequence TGTAGATGGCTCCAGTATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063123706_1063123710 4 Left 1063123706 10:3122704-3122726 CCCTGGGCAGCATTTAGGTTTGA No data
Right 1063123710 10:3122731-3122753 TGTAGATGGCTCCAGTATACTGG No data
1063123707_1063123710 3 Left 1063123707 10:3122705-3122727 CCTGGGCAGCATTTAGGTTTGAG No data
Right 1063123710 10:3122731-3122753 TGTAGATGGCTCCAGTATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063123710 Original CRISPR TGTAGATGGCTCCAGTATAC TGG Intronic