ID: 1063123710 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:3122731-3122753 |
Sequence | TGTAGATGGCTCCAGTATAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1063123706_1063123710 | 4 | Left | 1063123706 | 10:3122704-3122726 | CCCTGGGCAGCATTTAGGTTTGA | No data | ||
Right | 1063123710 | 10:3122731-3122753 | TGTAGATGGCTCCAGTATACTGG | No data | ||||
1063123707_1063123710 | 3 | Left | 1063123707 | 10:3122705-3122727 | CCTGGGCAGCATTTAGGTTTGAG | No data | ||
Right | 1063123710 | 10:3122731-3122753 | TGTAGATGGCTCCAGTATACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1063123710 | Original CRISPR | TGTAGATGGCTCCAGTATAC TGG | Intronic | ||