ID: 1063124585

View in Genome Browser
Species Human (GRCh38)
Location 10:3127382-3127404
Sequence TAATGGCAAAAGAATTCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063124585_1063124590 28 Left 1063124585 10:3127382-3127404 CCCGCAGAATTCTTTTGCCATTA 0: 1
1: 0
2: 0
3: 14
4: 199
Right 1063124590 10:3127433-3127455 GACAGTAATTCCCCACCTCAGGG No data
1063124585_1063124589 27 Left 1063124585 10:3127382-3127404 CCCGCAGAATTCTTTTGCCATTA 0: 1
1: 0
2: 0
3: 14
4: 199
Right 1063124589 10:3127432-3127454 TGACAGTAATTCCCCACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063124585 Original CRISPR TAATGGCAAAAGAATTCTGC GGG (reversed) Intronic
900368693 1:2321936-2321958 TATTTGCAAAAGAATCCTTCAGG - Intronic
900571053 1:3358396-3358418 TGATGGCAAAAGACCTCGGCGGG + Intronic
902574742 1:17370570-17370592 TAAGGGAAAAAGGCTTCTGCAGG - Intergenic
907487662 1:54788529-54788551 TAATGGCAAAACAGTTCAGGGGG - Intronic
910061201 1:83094658-83094680 TACTGGTAAAAGAATTCTTTAGG + Intergenic
910680285 1:89856498-89856520 TAATGACAGATGAATACTGCAGG - Intronic
911017466 1:93348424-93348446 AAATTGCAAAAGATTTCAGCAGG + Intronic
911876893 1:103177476-103177498 AAATAGAAAAAGAATTCTTCAGG - Intergenic
912043671 1:105425274-105425296 TAGTGGAAAAAAAATTCTTCAGG + Intergenic
912085542 1:105998237-105998259 TAATTGCCACACAATTCTGCAGG + Intergenic
913461391 1:119089742-119089764 TAATTACAAAAGAATTATACTGG + Intronic
914203098 1:145503980-145504002 CTATGGTAAAAGAGTTCTGCAGG + Intergenic
914482220 1:148077134-148077156 CTATGGTAAAAGAGTTCTGCAGG + Intergenic
914972652 1:152324714-152324736 TAATGGAAAAAGAATTGTCTTGG - Intronic
916158287 1:161880557-161880579 TAATCTCAAAATAATTCTGCTGG - Intronic
917245226 1:172993718-172993740 TATTGTCAAAAGAAATCTGGAGG - Intergenic
918765860 1:188482538-188482560 TAATGACAAAAGAATGCTCTGGG + Intergenic
918926063 1:190787788-190787810 TAATGCCAAAAGAAGTCACCTGG - Intergenic
920023460 1:202973939-202973961 CAATTCCAAAAGAATTCTGCTGG + Intergenic
920073315 1:203319131-203319153 GAATGGCAAAGAAAGTCTGCAGG - Intergenic
921560121 1:216647268-216647290 TAATGACAAAAAAATAATGCTGG + Intronic
923913048 1:238471332-238471354 TTATGGCAAGAGCATTCTGTAGG + Intergenic
1063124585 10:3127382-3127404 TAATGGCAAAAGAATTCTGCGGG - Intronic
1066070007 10:31798494-31798516 TCTTGTCAAAAGAATTCTGGAGG - Intergenic
1066264950 10:33767496-33767518 AAATGGCAAAAGAACTATGTTGG - Intergenic
1070826953 10:79396692-79396714 TAATGGCATATGAATTCTCTGGG - Intronic
1071029585 10:81160407-81160429 TAATTGTTATAGAATTCTGCAGG + Intergenic
1071833240 10:89392974-89392996 AAATGGGAAAAGAGTTTTGCAGG + Intronic
1072697243 10:97612881-97612903 TAAAGGCAAAAGAGCTCTGATGG + Intronic
1072886809 10:99284428-99284450 CAATGGCAAAAGAATGAAGCTGG + Intergenic
1074119602 10:110484007-110484029 TACTGGTATAAAAATTCTGCTGG - Intergenic
1074701758 10:116098483-116098505 TAATTTCAAAAGAATTTTCCTGG + Intronic
1074898971 10:117800773-117800795 TAATGGCAAAAACATACTGTGGG - Intergenic
1075448586 10:122531051-122531073 ATATGGCAAAAGAACTTTGCAGG + Intergenic
1078959001 11:16241114-16241136 TTATGGAAAAAGAATTGTGGAGG - Intronic
1080595675 11:33772879-33772901 ACATGGCAAATCAATTCTGCAGG + Intronic
1080843946 11:36009739-36009761 TAATGGAAAAAAAATGTTGCAGG - Intronic
1083161020 11:60854176-60854198 TTAGGGCAAGAGGATTCTGCTGG + Intronic
1085930888 11:81082404-81082426 TAATGGAAAAAGAAAACTTCAGG - Intergenic
1086485229 11:87293232-87293254 TAAAGGCAAAAGAATTCAGATGG - Intronic
1086599889 11:88620074-88620096 TAATGGCAAAAGATTAATTCTGG - Intronic
1087449720 11:98304174-98304196 TAATGGTAATAGAATTATTCAGG + Intergenic
1087686624 11:101272796-101272818 TAAGGGCCAAAGAGTCCTGCTGG - Intergenic
1090252517 11:125261839-125261861 TAAGTGCAAAAGCAATCTGCTGG + Intronic
1090410798 11:126508405-126508427 GGATGGCAAATGAATGCTGCGGG + Intronic
1092040493 12:5379904-5379926 TCAGGGCAAAGGCATTCTGCTGG - Intergenic
1093552143 12:20426388-20426410 TAATGCCTAAGGAATTCTTCAGG - Intronic
1093836183 12:23831849-23831871 TCATGGCAAAACAATTTTGGAGG + Intronic
1094774858 12:33713950-33713972 TAATTTCAAAAGAAATCTGGGGG - Intergenic
1095363170 12:41368670-41368692 TAATGCCAACTGAAATCTGCAGG - Intronic
1095451387 12:42334597-42334619 TAATGTCAAAAGATTTTTGGTGG - Intronic
1097489817 12:60252668-60252690 TAATGGAAAAAAAAATCTACAGG + Intergenic
1102188432 12:110967329-110967351 TTATGGCAGAAGAAATCTCCAGG - Intergenic
1102446470 12:113006826-113006848 CACTGGCCAAAGAATTCTGCAGG + Intronic
1104087214 12:125486632-125486654 CAATGGCAAAATAATTTTCCGGG - Intronic
1107142006 13:37009162-37009184 TATTGGCAAAATAATTTTTCAGG + Exonic
1107631282 13:42344962-42344984 TACTGGAAAAATAATTATGCTGG - Intergenic
1109650393 13:65316265-65316287 TAATGGCTAAAGACATCTGCAGG + Intergenic
1113562333 13:111291608-111291630 TAATTTCAAAGGAATTCTGACGG - Intronic
1114034583 14:18610918-18610940 TAATAGTTAAAGAATTTTGCAGG + Intergenic
1114124062 14:19704091-19704113 TAATAGTTAAAGAATTTTGCAGG - Intergenic
1115040131 14:28914257-28914279 CAATAGCAATAGAATTCAGCAGG - Intergenic
1116665168 14:47765528-47765550 TAATAGGAAAAGAATGGTGCTGG + Intergenic
1117592957 14:57294234-57294256 TACTGGAAAAAAAATTCAGCAGG - Exonic
1119087733 14:71752931-71752953 TAATGGCAAAAGAATCCCAATGG + Intergenic
1120840048 14:89077697-89077719 TAATGGCAAATGAATCATCCTGG - Intergenic
1121057593 14:90872497-90872519 TCATGGGAAAAAAATTCTGAGGG + Intronic
1121857088 14:97280264-97280286 TAGGGGCACAAGAATCCTGCTGG + Intergenic
1123178882 14:106448142-106448164 TCAAGGCAAAACAATTCTTCAGG + Intergenic
1125275175 15:37981249-37981271 ACATGGCAAAACTATTCTGCTGG - Intergenic
1127451914 15:59124745-59124767 TAATCACAAATGACTTCTGCAGG + Exonic
1133818038 16:9213095-9213117 TAATGACATAAGAGTTCTGTTGG + Intergenic
1138321679 16:56119465-56119487 TCCTGCCAAAAGAATTGTGCAGG + Intergenic
1139717514 16:68825388-68825410 GAATGGAAAAAGAATTTTGGAGG + Intronic
1149605560 17:57922568-57922590 TAATGGCAAAAGAAGCCTCGGGG + Intronic
1149935416 17:60801084-60801106 TAATTGCAAAAAAATCTTGCTGG + Intronic
1153164231 18:2243753-2243775 TCATGGCAAAATAATTTTGTAGG - Intergenic
1155020249 18:21889696-21889718 TAAATGCAAAAGAAAACTGCTGG + Intergenic
1155546067 18:26916894-26916916 CAATTGGAAAAGAATTCTGATGG - Exonic
1155885960 18:31208294-31208316 TAATGGCCATAGAATATTGCAGG + Intergenic
1156677350 18:39544491-39544513 AAATGGCAAAAGATGACTGCTGG - Intergenic
1156801071 18:41114651-41114673 TAATGCCAAAAGTATTATGGTGG - Intergenic
1156891952 18:42200734-42200756 TAATGGAAAAAGAATGCAGTGGG - Intergenic
1157219844 18:45820556-45820578 GAATGGCAGAAGAAGCCTGCGGG - Intergenic
1157426602 18:47589749-47589771 CAATGGTAAAAGAATTTTACAGG + Intergenic
1158851289 18:61497622-61497644 TAATGGGAAAAGCACTGTGCTGG + Intronic
1159091306 18:63852415-63852437 TCATGGCAAAACAATTGTTCAGG - Intergenic
1160106956 18:75987268-75987290 AACTGACAAAGGAATTCTGCTGG + Intergenic
1161259017 19:3325622-3325644 TACTTGCAAAAGAATTTTACTGG + Intergenic
1164848479 19:31457630-31457652 TAATACAAAAAAAATTCTGCAGG - Intergenic
1165284211 19:34825798-34825820 TCAAGGCAAAAGACTTCTTCAGG + Intergenic
1168198635 19:54796523-54796545 TTGTGGCAAAAGACTTCTGAAGG + Intronic
1168427632 19:56252037-56252059 TAAAGAAAAAAGAATTCTGAAGG + Intronic
925387058 2:3469381-3469403 AAATGGTAAAATAATACTGCAGG + Intronic
927079514 2:19613673-19613695 TAATGGAATAAGCATTCTGTTGG + Intergenic
927158049 2:20233217-20233239 TAAAGGCAAAACACTTCTACAGG - Intergenic
929837864 2:45424809-45424831 TAATGGCAAATGAAATGTGAGGG + Intronic
935838266 2:107078739-107078761 TCATGGCAAAAGCAGCCTGCTGG + Intergenic
935902461 2:107807202-107807224 TAATGGGAAAATAATTGTGCTGG - Intergenic
936933611 2:117815600-117815622 TAATTGAAAAAAAATTCTGCAGG + Intronic
938276678 2:130032058-130032080 TAATAGTTAAAGAATTTTGCAGG - Intergenic
938327636 2:130422827-130422849 TAATAGTTAAAGAATTTTGCGGG - Intergenic
938362312 2:130698651-130698673 TAATAGTTAAAGAATTTTGCGGG + Intergenic
939110955 2:138006603-138006625 TTATGGCTACAGTATTCTGCTGG + Intronic
939310766 2:140472103-140472125 AAATGGCAAAACAAATATGCAGG - Intronic
940682425 2:156803720-156803742 TAATGGCAAATGAAATATGCTGG + Intergenic
940709897 2:157149346-157149368 TTATTGCAGAATAATTCTGCAGG + Intergenic
941453064 2:165682701-165682723 TAATGGAAAAAAAAGTCAGCTGG - Exonic
944170072 2:196765712-196765734 TAATAGAAAAACAATTGTGCCGG + Intronic
946078689 2:217097536-217097558 TAATAGAAAAAGAGTTTTGCAGG - Intergenic
946950689 2:224871311-224871333 TAATGGAAAAAGAAATCTCAAGG - Intronic
948234227 2:236375558-236375580 TAATAGCATAAGAATTTTGCTGG - Intronic
1170045039 20:12075935-12075957 AGATGGAAGAAGAATTCTGCTGG - Intergenic
1171027079 20:21640607-21640629 AGATGGCAAAAGCATTCTGCAGG + Intergenic
1171995445 20:31727377-31727399 AAATGGCAAAAGAATAATGTAGG + Intergenic
1176292500 21:5053724-5053746 AAGTGGCAAAAGTATTCTCCAGG - Intergenic
1178127065 21:29527018-29527040 TAAGGGAAAAATAATTCTGTGGG - Intronic
1179864758 21:44209926-44209948 AAGTGGCAAAAGTATTCTCCAGG + Intergenic
1180458701 22:15537965-15537987 TAATAGTTAAAGAATTTTGCAGG + Intergenic
951183911 3:19689480-19689502 TACTTGCAAAAGAATTCAGAAGG + Intergenic
951806091 3:26645763-26645785 TAATGGAAAAAAAATTATGAGGG + Intronic
953144286 3:40260097-40260119 TGATGACAAAATAATTCTTCTGG - Exonic
954036128 3:47852212-47852234 AACTGGCAAAATAGTTCTGCAGG - Exonic
955868174 3:63408047-63408069 TAATGGCAGTGGAAATCTGCAGG + Intronic
959608346 3:108266536-108266558 CAATGGAAAGAGAATTCTGGAGG + Intergenic
960492847 3:118338147-118338169 TAATGGTATAAAAATGCTGCAGG + Intergenic
963406081 3:144865988-144866010 TAATGGTTAAAGTATTCAGCTGG - Intergenic
964283846 3:155096460-155096482 TATTGGCAAAAGAAATAAGCAGG + Intronic
964584176 3:158277538-158277560 TAAAGGCAGAAAAATACTGCTGG + Intronic
964883807 3:161456785-161456807 TAATGGCATTAGGATTATGCTGG - Intergenic
965054596 3:163697173-163697195 TGATGGCACAAGGCTTCTGCAGG + Intergenic
965698327 3:171433857-171433879 TAATGTAATAAGAAATCTGCAGG - Intronic
967010803 3:185431718-185431740 TAATGGTAACTGAAGTCTGCTGG - Intronic
969503375 4:7568776-7568798 TAATTGCAATAGACTTCTACTGG - Intronic
970270325 4:14339656-14339678 TATAGGCAAAAGCATTCTTCTGG - Intergenic
970848781 4:20576195-20576217 TCATGGCAGAAGAATTCTTATGG + Intronic
971404118 4:26305105-26305127 TAGTGTCAAAAGAATTCAGTGGG - Intronic
974419490 4:61654084-61654106 ACATGGGAAAAGTATTCTGCAGG + Intronic
976412695 4:84734785-84734807 GAATGTCAACAGAATTCAGCTGG + Intronic
978823125 4:112988890-112988912 AAATGGTAAAAAAATTCTGATGG + Intronic
979285447 4:118919027-118919049 AAATGGCAAAACATTTCTGCTGG - Intronic
983373287 4:166892774-166892796 TAGTGTCAAAATCATTCTGCAGG - Intronic
985284721 4:188324084-188324106 TAATAATAAAAGAATTTTGCTGG - Intergenic
986771331 5:10976721-10976743 TAATGACAAAAGACTTCTTTGGG + Intronic
987000976 5:13659309-13659331 TACTGGCAGAAGAACTCTGAAGG - Intergenic
990218657 5:53562727-53562749 TAATGGAAAAAGAATGCTTAAGG - Intronic
990534755 5:56709629-56709651 TAATGAAAAAAGAAAACTGCAGG + Intergenic
993415932 5:87630960-87630982 TAAAGGAAACAGAATTCTGATGG - Intergenic
997787467 5:136726659-136726681 GAATAGCAGAAGAATCCTGCGGG - Intergenic
999069726 5:148731034-148731056 TATTGTCAAATGAATTGTGCTGG - Intergenic
999577521 5:152996041-152996063 TAAAAGCAAAAGAACTCTGTAGG - Intergenic
999716442 5:154364610-154364632 AAAGGGCAAAAGTATTCTCCTGG - Intronic
1001012429 5:168110415-168110437 AAGTGGGATAAGAATTCTGCAGG - Intronic
1003410898 6:5862154-5862176 TGATGGGAGAAGGATTCTGCAGG + Intergenic
1003970795 6:11297255-11297277 TCCTGGGAAAAGAATGCTGCAGG + Intronic
1004080161 6:12384217-12384239 TAATGACCAAATAATTCTGTGGG - Intergenic
1004880616 6:20003682-20003704 TGATGACCAAAGAATTTTGCAGG + Intergenic
1005277956 6:24239785-24239807 TAATGCAAAAAGAATTTTGTGGG + Intronic
1005902576 6:30230151-30230173 TAATCACAAAATAATTATGCTGG - Intergenic
1008049653 6:46887284-46887306 TAAAGGCAAAAGATCTGTGCCGG + Intronic
1008234085 6:49023098-49023120 TAATGAAAAAAGAATACTACAGG - Intergenic
1010797049 6:80129363-80129385 TATAGGCCAAAGGATTCTGCGGG - Intronic
1011597983 6:89034505-89034527 TAATGGCAGCAGAATTTTGGAGG + Intergenic
1016506179 6:144782740-144782762 TAATGGCAAATGAGTTATGCTGG - Intronic
1016778912 6:147936807-147936829 TCATGCCAAAAGAAGTTTGCAGG + Intergenic
1018243246 6:161799022-161799044 TATTGGCAAAAGCAGTCTGAGGG - Intronic
1019085937 6:169476822-169476844 TAATAGCATAATAATTCTGTTGG + Intronic
1021680931 7:23131046-23131068 TTAAGGGTAAAGAATTCTGCTGG + Intronic
1022618875 7:31962010-31962032 AAATGGCAAAAGAAAACTGATGG + Intronic
1024597422 7:50951492-50951514 TAATGGTTCAAGACTTCTGCTGG - Intergenic
1025250010 7:57345300-57345322 TACTGGCTCAGGAATTCTGCAGG + Intergenic
1026644285 7:72154363-72154385 TGACGGCAAATGAATTCTTCTGG - Intronic
1027538085 7:79432472-79432494 TCTTGGCAGAAGAATTCTGAAGG + Intronic
1029899902 7:104028188-104028210 TAAGGGCAAAAGCAAACTGCTGG - Intergenic
1030414923 7:109231283-109231305 TAAAAGCAAAATAAGTCTGCTGG - Intergenic
1030475269 7:110024422-110024444 TAATGGCATGAGAATACTGAGGG + Intergenic
1030544983 7:110882151-110882173 TAGTGGCAAAAGAATTCAGAAGG + Intronic
1031339702 7:120583926-120583948 TAATGTCTGAAGAATTCAGCAGG + Intronic
1031580559 7:123469333-123469355 TAATGGCAAAACAATTGAGATGG - Exonic
1037070018 8:14633184-14633206 TAATGCCAGATGAATTATGCAGG - Intronic
1039230040 8:35435396-35435418 AGCTGGCAAAAGAATTATGCTGG + Intronic
1040881977 8:52215519-52215541 TGATGACAAAAGAGTTCTGGTGG - Intronic
1042163657 8:65923632-65923654 TAATGGGCAAAGAATACTACTGG + Intergenic
1043078290 8:75730536-75730558 TAAAGGCAAAACAATTGTTCAGG - Intergenic
1044544532 8:93444863-93444885 AAATGGCAAAAGGATTCTGTTGG - Intergenic
1047887409 8:129267054-129267076 TAAAAAAAAAAGAATTCTGCAGG + Intergenic
1048284368 8:133130353-133130375 CCATGGCAAAAGAACTTTGCAGG + Intronic
1048633973 8:136275633-136275655 TAATGGCACAAGTCTTCGGCTGG + Intergenic
1050308648 9:4330874-4330896 TAATGGCAAAGGTGATCTGCAGG - Intronic
1052452364 9:28648300-28648322 TAATGTCAAAATAATTATTCTGG - Intronic
1053296315 9:36916457-36916479 TAAAGTCAAAAGAAATCTGTTGG + Intronic
1053408091 9:37895180-37895202 TAATGGCAAAACAATTCACATGG - Intronic
1053567907 9:39272241-39272263 TAATGGACAAAGAGATCTGCTGG + Intronic
1053833910 9:42113185-42113207 TAATGGACAAAGAGATCTGCTGG + Intronic
1054129239 9:61346763-61346785 TAATGGACAAAGAGATCTGCTGG - Intergenic
1054596640 9:67074224-67074246 TAATGGACAAAGAGATCTGCTGG - Intergenic
1054893852 9:70284861-70284883 TATTGGAAAAAGTTTTCTGCTGG - Intronic
1058179804 9:101783260-101783282 TAATGGTAAATAAATACTGCAGG + Intergenic
1060009129 9:120027937-120027959 TCTTGCCAAAACAATTCTGCTGG - Intergenic
1185531109 X:819904-819926 TCAAGGCAAAAGAATCCTCCTGG + Intergenic
1189088621 X:38053830-38053852 TAATAGCAAAATAATAGTGCTGG + Intronic
1189776707 X:44476389-44476411 TAATGGCAAGAAGATCCTGCTGG - Intergenic
1191713149 X:64174231-64174253 TTAGGGCAAAAGAGTCCTGCAGG + Intergenic
1193123093 X:77843830-77843852 TACTGGCAAAAAAATACTGGGGG - Intronic
1193188483 X:78540870-78540892 TAATAGGAAAAGGATTGTGCTGG - Intergenic
1193284417 X:79695328-79695350 TAATGGCAAAAATAATCAGCTGG - Intergenic
1193870729 X:86795083-86795105 TAATGGGAAATGAATAATGCAGG + Intronic
1194919487 X:99747822-99747844 TAATAACAAAAGAATTCAGAAGG + Intergenic
1195143656 X:101990213-101990235 TAATGCCAGAGGAATTATGCTGG + Intergenic
1197569029 X:128126886-128126908 TATAGCCAAAAGAATTCAGCGGG + Intergenic
1198120001 X:133582978-133583000 TAGTGGCAAAACAAATCTGGAGG + Intronic
1199058245 X:143323376-143323398 TAATGGAAAAATAATTATGGTGG + Intergenic
1201788499 Y:17810800-17810822 TCAGGGCATAAGACTTCTGCAGG + Intergenic
1201813054 Y:18095188-18095210 TCAGGGCATAAGACTTCTGCAGG - Intergenic