ID: 1063124586

View in Genome Browser
Species Human (GRCh38)
Location 10:3127383-3127405
Sequence TTAATGGCAAAAGAATTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063124586_1063124589 26 Left 1063124586 10:3127383-3127405 CCGCAGAATTCTTTTGCCATTAA 0: 1
1: 0
2: 3
3: 29
4: 291
Right 1063124589 10:3127432-3127454 TGACAGTAATTCCCCACCTCAGG No data
1063124586_1063124590 27 Left 1063124586 10:3127383-3127405 CCGCAGAATTCTTTTGCCATTAA 0: 1
1: 0
2: 3
3: 29
4: 291
Right 1063124590 10:3127433-3127455 GACAGTAATTCCCCACCTCAGGG No data
1063124586_1063124591 30 Left 1063124586 10:3127383-3127405 CCGCAGAATTCTTTTGCCATTAA 0: 1
1: 0
2: 3
3: 29
4: 291
Right 1063124591 10:3127436-3127458 AGTAATTCCCCACCTCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063124586 Original CRISPR TTAATGGCAAAAGAATTCTG CGG (reversed) Intronic
902206195 1:14869943-14869965 TTAATGGCAAAGTAATGCCGGGG - Intronic
902689694 1:18102748-18102770 TTAATGGAAAGAGGGTTCTGAGG + Intergenic
904515901 1:31054812-31054834 ATTATGGCAAAACAATTCTTTGG + Intronic
904734420 1:32619702-32619724 TAAAAGGTAAAAGGATTCTGAGG + Intronic
907487663 1:54788530-54788552 ATAATGGCAAAACAGTTCAGGGG - Intronic
910405029 1:86879562-86879584 TTAATGGCAAGAGAATTTTTTGG - Intronic
910410236 1:86935277-86935299 TTAATGACTTAACAATTCTGAGG - Intronic
911204021 1:95074828-95074850 TTAATGGAATCAGAATTCTCTGG + Intergenic
912715299 1:111979295-111979317 TGAATGACAAAAGAAGTCAGCGG + Intronic
913534446 1:119757943-119757965 TAAATGCCACAAGAATTCAGAGG + Intronic
916236596 1:162595100-162595122 TGCATGGCTAAAGAATTGTGGGG + Intronic
916362508 1:163986512-163986534 TTAATATCAAGATAATTCTGTGG + Intergenic
916575857 1:166065762-166065784 TTAATGGCAATAAGACTCTGGGG + Intronic
917379415 1:174387678-174387700 CAAATGGGAAAAGACTTCTGAGG + Intronic
918765859 1:188482537-188482559 TTAATGACAAAAGAATGCTCTGG + Intergenic
919090524 1:192973636-192973658 TTCATTCCCAAAGAATTCTGTGG - Intergenic
919359236 1:196569621-196569643 TTTATGGCAAAACAGTGCTGAGG + Intronic
919874233 1:201850608-201850630 TTAATTCCAAAAGTTTTCTGAGG - Intronic
919955742 1:202413439-202413461 TAAATGGCAAAAGATTACTGTGG - Intronic
920927774 1:210358817-210358839 TTGATGGGAAATTAATTCTGGGG - Intronic
1063124586 10:3127383-3127405 TTAATGGCAAAAGAATTCTGCGG - Intronic
1064858784 10:19801808-19801830 TTTATAGCAAACTAATTCTGTGG + Intergenic
1065669865 10:28104418-28104440 TAAATGGCAAAACTATTCTATGG - Intronic
1068550046 10:58397302-58397324 TTAATGTTAAAAGAACTCAGAGG - Exonic
1070109878 10:73474865-73474887 TTAAGTCCAAAAGAATACTGAGG + Intronic
1070826954 10:79396693-79396715 GTAATGGCATATGAATTCTCTGG - Intronic
1072262022 10:93686979-93687001 TTAATCCCAATAGAATTTTGGGG - Intronic
1073918969 10:108437329-108437351 TATATGGCAGAAGAATGCTGAGG + Intergenic
1074234417 10:111570748-111570770 TAAATGACAAAATAAATCTGTGG + Intergenic
1074847121 10:117408147-117408169 TTAATGGGAAAAGTGTTTTGTGG - Intergenic
1074898972 10:117800774-117800796 ATAATGGCAAAAACATACTGTGG - Intergenic
1078153743 11:8780459-8780481 CAAATGGCAAAAGAATACAGGGG + Intronic
1079354997 11:19723444-19723466 TTACTGGCAAAAGAAGGCAGTGG - Intronic
1079638577 11:22775955-22775977 TAAATGGCCAAAGAATGCTCTGG - Intronic
1080078778 11:28186830-28186852 TTAATAGCAAGAGGATTCTTTGG + Intronic
1080146560 11:28992543-28992565 TTCATGGAAAAAGAAGCCTGAGG + Intergenic
1080784861 11:35465911-35465933 TTAATGGAATAACAATGCTGAGG + Intronic
1081112588 11:39155177-39155199 TGAATGGCAACAGTATTCTAGGG + Intergenic
1081555684 11:44158328-44158350 TTAATGGCTAAAGTACTCTGGGG - Intronic
1081832371 11:46124364-46124386 TTAATGGAAAAAAAATACTCTGG + Intergenic
1081923415 11:46801367-46801389 TTATTCTCAAAAGAACTCTGAGG + Intronic
1082926393 11:58551871-58551893 TTTATGGGAAAAGCATTCTAGGG + Intronic
1084369097 11:68726688-68726710 TTATTGCCACCAGAATTCTGTGG - Intronic
1085966077 11:81528400-81528422 TTAATTGCCAAAGAATTTTGTGG + Intergenic
1086903618 11:92394924-92394946 TTAATGGGAACTGAATTCTGAGG - Intronic
1086915453 11:92524915-92524937 TTGATGGCAAAAAAATTCTGAGG - Exonic
1087214120 11:95476805-95476827 TGAAGCTCAAAAGAATTCTGAGG + Intergenic
1089701557 11:120247444-120247466 TTTATGGCAAATGCATACTGTGG - Intronic
1089872834 11:121692135-121692157 TTTGTGGCAAAAGAATACTAGGG - Intergenic
1090160707 11:124491749-124491771 TTAATTGCTAAAGATTTCTTGGG + Intergenic
1092555912 12:9561371-9561393 TGAATGGCAAGAAAGTTCTGGGG + Intergenic
1092612199 12:10184412-10184434 TGATTGGCATCAGAATTCTGGGG + Intronic
1092926922 12:13279842-13279864 TTCATGGCACAACAAATCTGTGG + Intergenic
1094516186 12:31129299-31129321 TGAATGGCAAGAAAGTTCTGGGG - Intergenic
1094761971 12:33544286-33544308 ATAATGGCAAAATGATCCTGGGG + Intergenic
1094774859 12:33713951-33713973 CTAATTTCAAAAGAAATCTGGGG - Intergenic
1095133132 12:38567064-38567086 TTAATGGTAAATGCTTTCTGTGG - Intergenic
1095418952 12:42005403-42005425 TGAAAGGCAACAGAATTCTTTGG - Intergenic
1095736319 12:45560424-45560446 TTAGTGGCAAGAAAATACTGGGG - Intergenic
1097374949 12:58831109-58831131 TCAATTGCAAAAGCATTCAGTGG + Intergenic
1097479239 12:60100393-60100415 TTAATGGCAAAGGAATGCTTTGG + Intergenic
1097494204 12:60309625-60309647 TTAAGGGCAAAAGCCTTCTTAGG + Intergenic
1098622153 12:72614719-72614741 TTAAAGGCAATTGATTTCTGGGG - Intronic
1099647839 12:85382044-85382066 TAAATGGAAAAATAATACTGGGG - Intergenic
1099864293 12:88259712-88259734 TTAAAGACAAAAAAATTCTTTGG - Intergenic
1100513290 12:95299026-95299048 TTCATGGGAAAAGCATTCTATGG - Intronic
1100583818 12:95960853-95960875 TTAATAGCAAAAGAATTGGCTGG + Intronic
1101525678 12:105527071-105527093 TTAAAAGCAAAAGGATTGTGGGG - Intergenic
1104087215 12:125486633-125486655 TCAATGGCAAAATAATTTTCCGG - Intronic
1104276171 12:127329940-127329962 CCAAAGGCAAAAGAAGTCTGGGG + Intergenic
1104545038 12:129703093-129703115 CGAATGGCAAAAGAGTGCTGAGG - Intronic
1106832900 13:33604133-33604155 TGAATGGCAAAATAGTTCTGAGG + Intergenic
1108808922 13:54196144-54196166 TTAGTGACCAAAGAAATCTGAGG - Intergenic
1108902206 13:55425298-55425320 TTACTGGGAAAAGAATTCAGTGG + Intergenic
1109707936 13:66123516-66123538 TCAATGAAAATAGAATTCTGAGG + Intergenic
1109943839 13:69406419-69406441 GTAATCACAAAAGATTTCTGAGG + Intergenic
1109968224 13:69729685-69729707 TTAATGGCTTTAAAATTCTGTGG - Intronic
1111073302 13:83198934-83198956 TGAATGGCAAAACAATTCAAAGG - Intergenic
1111393227 13:87626613-87626635 GTAATGGCACAAAAATCCTGGGG + Intergenic
1113145835 13:107206142-107206164 TTAATTGGAAAGAAATTCTGAGG - Intronic
1114441118 14:22748828-22748850 TTAATTCCAAAACAACTCTGTGG - Intergenic
1115153492 14:30312444-30312466 TAAATGGCAATAGAATAATGGGG + Intergenic
1115639569 14:35324728-35324750 TCAATGGGAAAATAATTCTAGGG + Intergenic
1116183173 14:41561539-41561561 TTTTTGGCAAAAAAATTATGTGG + Intergenic
1117799066 14:59425101-59425123 TTAATGGAACAAGATTCCTGAGG - Intergenic
1118007791 14:61580508-61580530 TGAATTGGAAAAGAGTTCTGAGG - Intronic
1119241835 14:73066770-73066792 TTTAAGTCAAAGGAATTCTGAGG + Intronic
1120250676 14:82059067-82059089 TTAATGACAAAACAAATTTGAGG - Intergenic
1120714554 14:87826423-87826445 TTAATGACAAAAGCATACTAAGG + Intergenic
1120989839 14:90365395-90365417 TTAATAACAAAAAAATTCTATGG + Intergenic
1121057592 14:90872496-90872518 TTCATGGGAAAAAAATTCTGAGG + Intronic
1121674998 14:95745343-95745365 TTAATGGCAAATGACTCTTGAGG - Intergenic
1126918418 15:53492145-53492167 TAGATGGCAAAAGAGCTCTGTGG + Intergenic
1127442993 15:59029687-59029709 TTATGGGCAAAACAAATCTGTGG + Intronic
1128357579 15:66938939-66938961 TTAATGATAAAAGAGTTCTAAGG + Intergenic
1131126787 15:89865587-89865609 GCACTGGCAAAAGAAGTCTGAGG - Intronic
1132278159 15:100588081-100588103 TTAATACAAAAGGAATTCTGAGG + Intronic
1133604469 16:7372653-7372675 AGAATGGAAAAAGAATACTGGGG - Intronic
1134368640 16:13603175-13603197 TTAATTGCACAAGAATCCTCAGG - Intergenic
1138273876 16:55716889-55716911 TCAATGGAAATAGAATTCAGTGG + Intergenic
1138333321 16:56232587-56232609 TTCATGCAAAAAGAGTTCTGAGG - Intronic
1138404419 16:56778167-56778189 TTAATAACGAATGAATTCTGGGG + Intronic
1138409014 16:56823062-56823084 TTACAGGCAGAAGGATTCTGGGG + Intronic
1139052820 16:63146593-63146615 TTATTTGAAAAAGAATTCTAAGG - Intergenic
1140819886 16:78653394-78653416 TTAGAGGCAAAAGGATTTTGGGG - Intronic
1141507424 16:84487040-84487062 TAGATGGCAAGAGACTTCTGGGG - Exonic
1141877032 16:86832652-86832674 TTAATGGCAAGAGAATCTTTTGG - Intergenic
1144113480 17:12062673-12062695 TTATTGGGTATAGAATTCTGGGG + Intronic
1146022806 17:29293476-29293498 TGAATGGGAAAAGAATAATGAGG + Intronic
1149605559 17:57922567-57922589 GTAATGGCAAAAGAAGCCTCGGG + Intronic
1149712796 17:58757485-58757507 TGAATGGCAAAAGACTTCCCAGG - Intronic
1150928241 17:69556708-69556730 TTAATAACAAAAGCATTTTGGGG + Intergenic
1151245974 17:72794950-72794972 TGAATGCCACCAGAATTCTGAGG + Intronic
1155718817 18:28984484-28984506 TTAAAGGCAGGAGAACTCTGAGG - Intergenic
1155929588 18:31691664-31691686 TTAATGACTAAATCATTCTGGGG + Intergenic
1156003145 18:32408463-32408485 TTAATGGCAAAAAAATTGTGAGG + Intronic
1156771536 18:40733080-40733102 TTTTTGGAGAAAGAATTCTGAGG - Intergenic
1156841992 18:41619774-41619796 TTAATGGCAAGATAAATCTTAGG - Intergenic
1156891953 18:42200735-42200757 GTAATGGAAAAAGAATGCAGTGG - Intergenic
1158611270 18:58942721-58942743 TTAATGCCAAAAGAAACCTTTGG - Intronic
1159209734 18:65302065-65302087 TAAAAGCCAAAAGAATTCTTAGG - Intergenic
1159568693 18:70086785-70086807 TTAATAGCAAAAGACATCTCTGG + Intronic
1162241456 19:9358140-9358162 TTAAGGGCAAAATAACTGTGAGG - Intronic
1164507150 19:28869949-28869971 TTACTGGGAAAAGAACCCTGAGG + Intergenic
1167118902 19:47505060-47505082 TTAAGGGCAGAAGAATGCAGTGG - Intronic
1168446874 19:56425927-56425949 TATATGCCAAAAGAATTCTGGGG - Exonic
925895563 2:8469364-8469386 TTAATGGAAAAAATATGCTGTGG - Intergenic
926228131 2:10982932-10982954 TTATTGGCAAAATAATTATTTGG - Intergenic
926726269 2:16000718-16000740 GGAATGGCAGAAGAATTCCGTGG - Intergenic
928477583 2:31646233-31646255 TTAATGTAAATAAAATTCTGAGG - Intergenic
928618215 2:33060452-33060474 TAAATGGCAAAATAATACTTTGG - Intronic
929837863 2:45424808-45424830 ATAATGGCAAATGAAATGTGAGG + Intronic
930391201 2:50763817-50763839 TTTATGGCAAAATTATTCGGTGG - Intronic
931041194 2:58302997-58303019 TTAATAACATAACAATTCTGAGG + Intergenic
931119552 2:59200577-59200599 TACATGGAAAAAGCATTCTGTGG + Intergenic
934868362 2:97835516-97835538 TTACTGGAAAAAAAATTTTGAGG + Intronic
938327637 2:130422828-130422850 TTAATAGTTAAAGAATTTTGCGG - Intergenic
938362311 2:130698650-130698672 TTAATAGTTAAAGAATTTTGCGG + Intergenic
938823987 2:134986674-134986696 TTAATGCCAAATGAAGTCTTTGG + Exonic
939938487 2:148321055-148321077 TTCATAACAAAGGAATTCTGTGG + Intronic
940115149 2:150200367-150200389 TTAATGGCAAAAAAATTAATCGG - Intergenic
940297538 2:152143383-152143405 TAAATGGCAGAGAAATTCTGAGG + Intronic
940393897 2:153165403-153165425 TTTATGGTATAAGAATTATGAGG - Intergenic
940480520 2:154224127-154224149 ATCATGGCAAAATAATTATGTGG + Intronic
941760065 2:169232577-169232599 TAAAGAGCAAAAGAATTATGAGG + Intronic
942275626 2:174321020-174321042 TAGATGGCAAAAGAAGTATGGGG - Intergenic
942593699 2:177572228-177572250 TTCATGGAAACAGAATACTGTGG + Intergenic
942718794 2:178925554-178925576 TTAATTACACAGGAATTCTGGGG + Intronic
943097466 2:183447702-183447724 TTCTTGGGAAAAGTATTCTGAGG + Intergenic
944299793 2:198110575-198110597 CTAATGGGAAAAGAAGTATGAGG + Intronic
945535869 2:211017307-211017329 TTAAAGGGAAAACAATTCTATGG - Intergenic
945704998 2:213219294-213219316 TCAATGTTAAAAGAATTGTGGGG + Intergenic
945987680 2:216368515-216368537 TCAATGGACAAAGAACTCTGGGG - Intronic
946760884 2:222992151-222992173 TAAATGGGAAAAGAATTCTCAGG - Intergenic
946914590 2:224504622-224504644 ATAAGGGCAAAAGGATTCTGTGG + Intronic
949061960 2:241966072-241966094 TTAAAGGCAAAAGAAGCTTGAGG - Intergenic
1169725043 20:8719028-8719050 TTGATGAGAAAAGAATTCAGTGG + Intronic
1170287652 20:14727993-14728015 TAAGTGGAAACAGAATTCTGGGG - Intronic
1171070106 20:22060119-22060141 TTAATGGCAAAGTAATTTTGAGG - Intergenic
1173304356 20:41834050-41834072 TTTTTGGCACAAGAATTCTATGG + Intergenic
1173733963 20:45346786-45346808 TGGAAGGCAAAGGAATTCTGAGG - Intronic
1175556951 20:59870662-59870684 TAAAGGGCAAAGGAATTCTGAGG + Intronic
1177022288 21:15876813-15876835 TAAATTGCATAAGAATTATGTGG + Intronic
1177636896 21:23798988-23799010 TTTATGTTAATAGAATTCTGTGG + Intergenic
1178127066 21:29527019-29527041 ATAAGGGAAAAATAATTCTGTGG - Intronic
1178249504 21:30988674-30988696 GTAATAGCAAAAGCATTCTTTGG + Intergenic
1178499570 21:33114737-33114759 TGAATGGCAAAATGATTCTCAGG + Intergenic
1179088995 21:38246416-38246438 TGCAGGCCAAAAGAATTCTGAGG + Intronic
1179130396 21:38631236-38631258 TTAATGGGAAATGAAGTGTGGGG - Intronic
1179426050 21:41279633-41279655 TTAAGGGGAAAAGAAATCTAAGG - Intronic
1181344375 22:22207447-22207469 TAAATAGCAAAAGAAGTCAGAGG + Intergenic
1182148440 22:28011926-28011948 TTAATGGAACAAGTAATCTGGGG + Intronic
1182744000 22:32591390-32591412 AAAATGGCAAAAGTTTTCTGGGG + Intronic
1184051325 22:42007524-42007546 TTAATGGGAACAGAATTGTTGGG - Intronic
1185230795 22:49679857-49679879 TTAATTGCAAAAGAACACTATGG + Intergenic
951806090 3:26645762-26645784 GTAATGGAAAAAAAATTATGAGG + Intronic
955250054 3:57272361-57272383 TTAATTTCAAAAGAATCCTCAGG + Exonic
956599071 3:70999417-70999439 TTAATCATAAAAGAACTCTGTGG + Intronic
957023189 3:75147597-75147619 TTAATGCAGAAATAATTCTGTGG - Intergenic
959275948 3:104277805-104277827 TTAATGAAAAAGGATTTCTGAGG - Intergenic
960387348 3:117036051-117036073 TTAAAAGCATAAGAATCCTGAGG + Intronic
960949622 3:122990778-122990800 TTAAAGGCAAAATACTTCTGAGG - Intronic
961050670 3:123743268-123743290 AGAATAGCAAAAGAATGCTGGGG + Intronic
961842478 3:129727385-129727407 TAAATGGTAGAAAAATTCTGGGG + Intronic
962497604 3:135957541-135957563 TTGCTGGGAAAAGAATTCAGCGG + Intergenic
962764114 3:138545664-138545686 TTGCTGGGAAAAGAATTCAGCGG - Intronic
963665628 3:148181928-148181950 TTAATAGCAAAAGCATTCTTTGG + Intergenic
964042495 3:152279004-152279026 TGAATGGCAAGGGAATGCTGTGG + Intronic
964937093 3:162103144-162103166 TCATTGGCAAAATGATTCTGTGG + Intergenic
964962390 3:162443448-162443470 TTATTAGCAAAAGGATGCTGAGG - Intergenic
965353705 3:167647539-167647561 GAAATGGCAGAGGAATTCTGTGG - Intronic
965588525 3:170341207-170341229 TTAATGTGAAAAGAATTCTAAGG - Intergenic
967505582 3:190249490-190249512 TTAATGTAAACAGAAATCTGGGG - Intergenic
970098574 4:12493391-12493413 TTACTGGTAAAAAAATTCTAAGG - Intergenic
970621388 4:17823047-17823069 TTGATGACAAAAGAATTCATAGG + Exonic
971404119 4:26305106-26305128 CTAGTGTCAAAAGAATTCAGTGG - Intronic
972759615 4:42090409-42090431 TTAAGGGAAAAAGTATCCTGAGG - Exonic
972920863 4:43939578-43939600 TTAATGGCAAAGAAAGGCTGTGG - Intergenic
974128323 4:57722282-57722304 TTAATGTCAAAGGACTTCAGTGG - Intergenic
974961192 4:68703287-68703309 TTGCTGGGAAAAGAATTCAGCGG - Intergenic
975234514 4:71976510-71976532 TTAATGTAAAAATAATTCTCTGG + Intergenic
976427566 4:84923540-84923562 TTAATGGCAATTTAATTCTTGGG + Intronic
976455667 4:85244273-85244295 TCAATCCCAATAGAATTCTGAGG - Intergenic
976552709 4:86414724-86414746 TTAAAAGCAAAAGATATCTGGGG - Intronic
977677444 4:99763480-99763502 TGAATGGCAAAATAAATCTAGGG + Intergenic
978951012 4:114559438-114559460 TTAATTTAAAAAAAATTCTGAGG - Intergenic
979180325 4:117718436-117718458 TTATTGGCAGAACAATTCTTGGG - Intergenic
979577625 4:122313739-122313761 TTAATGGCAAGAGAATCTTTTGG + Intronic
980192333 4:129541049-129541071 TTAATTGCTTTAGAATTCTGAGG + Intergenic
980561870 4:134487904-134487926 ATAAGGGCAAAATAATTCTCAGG + Intergenic
980638892 4:135546618-135546640 TTAATTGCATAAGAATACTTTGG + Intergenic
981120846 4:141049604-141049626 TTAATGACAAAAGTCTTCAGGGG + Intronic
983028935 4:162773734-162773756 GTAAAGGCAACAGAATTCAGTGG - Intergenic
983079298 4:163365536-163365558 TTAATGGCATAAGTGTTCTGAGG - Intergenic
984247697 4:177295605-177295627 TTGGTGCCAAAAGTATTCTGTGG - Intergenic
984269277 4:177531043-177531065 TTAATAGCAACTGAACTCTGAGG + Intergenic
984466950 4:180111553-180111575 TTAAGGGCAAAAGAAATGAGAGG - Intergenic
985434959 4:189919812-189919834 TTCATGGCAATAGATTTCTCTGG + Intergenic
985963076 5:3317943-3317965 TTAATGGAAAAAAAAATCAGAGG - Intergenic
986262343 5:6159310-6159332 TTAAGGAGAAAAGCATTCTGTGG + Intergenic
986771330 5:10976720-10976742 ATAATGACAAAAGACTTCTTTGG + Intronic
988316741 5:29640948-29640970 TTAAAGGGAAAATAATTATGAGG - Intergenic
988390802 5:30627377-30627399 TTCATGGAACAAGTATTCTGAGG - Intergenic
989399892 5:40997725-40997747 TTAGTGGCAGCAGAATTATGTGG + Intergenic
990157429 5:52894644-52894666 CTAAGGGGAAAAGAATTCTCTGG - Intronic
990366336 5:55074624-55074646 TTCATGGCAAGAGTATTATGTGG - Intergenic
990402534 5:55453542-55453564 ATAATGGAAAAAGAAATTTGAGG - Intronic
991154965 5:63422842-63422864 ATAATGGAAAGGGAATTCTGGGG + Intergenic
994240384 5:97412494-97412516 TTAAAGGCAAAAGACTTCTAGGG + Intergenic
994876336 5:105427145-105427167 TGATGGGCAAAAGAATTCAGGGG - Intergenic
995288952 5:110427363-110427385 TCATTGTCAAAAGAATTCAGAGG + Intronic
995978990 5:118078702-118078724 TGAATGGCAACAGAATGTTGAGG + Intergenic
996329718 5:122315009-122315031 GTAATTGAAAAGGAATTCTGAGG + Intronic
996373108 5:122774344-122774366 TTATTGAGAAAAGAATTATGTGG + Intergenic
996440166 5:123481047-123481069 TGAATGGCAACAGACTTCTGTGG - Intergenic
998725628 5:145010192-145010214 TACATGCCAAAACAATTCTGAGG - Intergenic
999657305 5:153823320-153823342 TTTATGGCTATGGAATTCTGCGG - Intergenic
999715531 5:154357067-154357089 TTAAAAGCAAAAAAAATCTGTGG - Intronic
1000235138 5:159351191-159351213 TTACTTACAAAAGAGTTCTGTGG - Intergenic
1001465310 5:171959483-171959505 TTAATGGAAAAAAAATTCCATGG - Intronic
1003174098 6:3742402-3742424 TTGATGGCATGACAATTCTGGGG + Intronic
1003192044 6:3882808-3882830 TAAATGGCAACAGATTTATGAGG - Intergenic
1003418498 6:5934869-5934891 TTAATGGGAACAGCATTCAGGGG - Intergenic
1004025343 6:11812888-11812910 TTCATGACAAAATAACTCTGAGG - Intergenic
1004080162 6:12384218-12384240 GTAATGACCAAATAATTCTGTGG - Intergenic
1004197613 6:13519084-13519106 ATGATGGCAAAAGAATGCAGAGG + Intergenic
1004411274 6:15383617-15383639 TGAATGGCAAAGGAAGGCTGGGG - Intronic
1004630061 6:17412521-17412543 GTAGTGGAAAAAGAACTCTGGGG - Intronic
1004668561 6:17772992-17773014 TTAATGGGAACAGTATTCTTTGG - Intronic
1005277955 6:24239784-24239806 ATAATGCAAAAAGAATTTTGTGG + Intronic
1005456943 6:26029308-26029330 TTTATGGCAAATGAATTATCAGG - Intergenic
1005656131 6:27939486-27939508 TTAATGGCAAAAGAAAGCTAAGG + Intergenic
1006819385 6:36879586-36879608 TTAATGCAAAAAAAATTCTGAGG + Intronic
1007159108 6:39774644-39774666 CTAAAGGGAAAAGAATTTTGGGG + Intergenic
1009050690 6:58272499-58272521 GTAATAGCAGAAAAATTCTGGGG - Intergenic
1010609213 6:77932476-77932498 TTCATGCAAAAACAATTCTGTGG - Intergenic
1010754185 6:79648052-79648074 TTAATGGAAAAAGAACTCAAAGG - Intronic
1011967731 6:93180405-93180427 TTCATAGCAAAAGCATTTTGAGG + Intergenic
1012243363 6:96898472-96898494 ATAATGGAAAAAGAATACAGTGG - Intergenic
1012526592 6:100185069-100185091 ATAATGCCAAAATTATTCTGAGG + Intergenic
1013855220 6:114564413-114564435 TTGCTGGCAAAATAATTCAGGGG - Intergenic
1015134816 6:129855902-129855924 TGAATGGCTAAAAAATTTTGGGG - Intronic
1015283782 6:131462099-131462121 ATAAAGTCAAAAGAATTCAGAGG + Intergenic
1016810527 6:148257103-148257125 TTAAGGGCAAAAGAAGTCATTGG + Intergenic
1016831644 6:148439878-148439900 TTCATGGTGAAATAATTCTGTGG - Intronic
1017550043 6:155496123-155496145 TTGAGGGCTAAAGAAATCTGAGG + Intergenic
1017927773 6:158924928-158924950 TTAATTGAAAAAGAATTTTAAGG + Intergenic
1018189089 6:161292665-161292687 GTAATGGAAAAATAATTCTGGGG + Intergenic
1018227258 6:161640131-161640153 TTAATGGAAAAAGGATTAAGTGG - Intronic
1018243247 6:161799023-161799045 TTATTGGCAAAAGCAGTCTGAGG - Intronic
1018450765 6:163905311-163905333 TTAATAGCATAAGGATGCTGAGG - Intergenic
1020028532 7:4916751-4916773 ATAATGGGGAAAGAATTCTGTGG + Intronic
1023042310 7:36182554-36182576 TTAATGACAAAAGAATGATCAGG - Intronic
1026648259 7:72191950-72191972 TTAATGGCAAAAAACTTCGATGG + Intronic
1027767345 7:82362341-82362363 TTAAAGTCTAAAGATTTCTGAGG + Intronic
1029019819 7:97352647-97352669 TAGATGGCTAGAGAATTCTGGGG + Intergenic
1029924429 7:104300724-104300746 TGAATGACAAAAGAATACGGTGG + Intergenic
1030475268 7:110024421-110024443 ATAATGGCATGAGAATACTGAGG + Intergenic
1030586548 7:111427131-111427153 TAAATGATAAAAGAATTCTAAGG - Intronic
1030772552 7:113492297-113492319 TGAGTGGCAGAAAAATTCTGAGG + Intergenic
1031594541 7:123633890-123633912 TTCATGACAAAAGAATTCAGGGG + Intronic
1031742955 7:125457168-125457190 TTAATGCAAAAAGAATTCTGAGG - Intergenic
1032183086 7:129698540-129698562 TTCATTGTAAATGAATTCTGGGG - Intronic
1034153160 7:148932646-148932668 TGAATGAGAAAAGAATTTTGTGG - Intergenic
1036145620 8:6252179-6252201 TAAGTGTCAAAATAATTCTGTGG + Intergenic
1036792678 8:11732452-11732474 TGCTTGGCTAAAGAATTCTGAGG + Intronic
1037518493 8:19657679-19657701 ATAAGGGCAAAACAAATCTGAGG + Intronic
1037932416 8:22889500-22889522 TTAAAGGCAAGAGAAGTCTAAGG + Intronic
1038561385 8:28583626-28583648 TAAAGGGGAAAAGAATCCTGAGG + Intergenic
1040813639 8:51483339-51483361 TTAAAGGAAAAAGAAGTCTTGGG + Intronic
1040974961 8:53179976-53179998 TTAATTTCAAAAACATTCTGTGG - Intergenic
1041199402 8:55436512-55436534 GTAATGGAAAAAGACTTCTGAGG - Intronic
1042036423 8:64539136-64539158 TTAATGGCAAGCAAATTCTTTGG - Intergenic
1042058528 8:64791836-64791858 CAAATGCTAAAAGAATTCTGAGG + Intronic
1042360063 8:67872112-67872134 TTAACTGAAAAAGAATTCAGTGG - Intergenic
1043723106 8:83572935-83572957 TTTAAGGCAAATGATTTCTGGGG + Intergenic
1044343593 8:91076362-91076384 TTGCTGGAAAAAGAATTCAGTGG + Intronic
1046095636 8:109556904-109556926 TTAATTGAAAAAGAATTATAGGG - Intronic
1047233651 8:123019453-123019475 TGAGTGGCAAATGCATTCTGAGG + Intronic
1047704777 8:127487098-127487120 TAAATGACAAAAGAAGTCTTGGG - Intergenic
1050283914 9:4081070-4081092 CTAATGGCCAAACAGTTCTGGGG - Intronic
1050714978 9:8513681-8513703 TTACTGACTAAAGAATTCTTAGG - Intronic
1050831047 9:10013499-10013521 TTAATTGGTAAAAAATTCTGAGG - Intronic
1051142602 9:13993878-13993900 TCTATGGGAAAAGAATTATGAGG - Intergenic
1051407929 9:16758943-16758965 TGAATGGGAAAAGTATTCTACGG + Intronic
1051784400 9:20726233-20726255 TTAAGGGGAAAAAAATTCTAAGG - Intronic
1056307492 9:85304501-85304523 TTTTTGGCTAAAGATTTCTGAGG + Intergenic
1056989767 9:91399875-91399897 TTAAGGGCAAAAAAATCATGGGG - Intergenic
1059292465 9:113238751-113238773 TTAATTTAAAAAGGATTCTGAGG - Intronic
1059689627 9:116672472-116672494 TCATTGGCAACTGAATTCTGAGG - Intronic
1059700364 9:116770046-116770068 TGAATGACATAAGAATACTGAGG + Intronic
1060579921 9:124736209-124736231 TTAATGTCCAAAGTAGTCTGAGG - Intronic
1062714464 9:138000037-138000059 TTAATTCCAAAAGAATACTTTGG + Intronic
1190421750 X:50291583-50291605 TTTATGGTGAAAGAATTATGGGG + Intronic
1190558051 X:51657742-51657764 TTTCTGGAAAAAAAATTCTGTGG + Intergenic
1193123094 X:77843831-77843853 ATACTGGCAAAAAAATACTGGGG - Intronic
1193744683 X:85261746-85261768 TTAGTGCCAGAAGAATTCTGTGG + Intronic
1194117415 X:89920336-89920358 TTAAGGGCAAAAGGAAACTGTGG + Intergenic
1194817492 X:98462195-98462217 CCAAGGGCAAAAGAATTCTCAGG + Intergenic
1200470205 Y:3577479-3577501 TTAAGGGCAAAAGGAAGCTGTGG + Intergenic
1202255207 Y:22913678-22913700 TTACTGGGGAAAGAATTCAGCGG + Intergenic
1202408198 Y:24547427-24547449 TTACTGGGGAAAGAATTCAGCGG + Intergenic
1202462584 Y:25122653-25122675 TTACTGGGGAAAGAATTCAGCGG - Intergenic
1202578866 Y:26357742-26357764 TAAACGGCAAAAGATTACTGTGG + Intergenic