ID: 1063124588

View in Genome Browser
Species Human (GRCh38)
Location 10:3127399-3127421
Sequence GAATGACATCAACCGCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063124588_1063124599 24 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124599 10:3127446-3127468 CACCTCAGGGTGGGCTGCGGGGG No data
1063124588_1063124590 11 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124590 10:3127433-3127455 GACAGTAATTCCCCACCTCAGGG No data
1063124588_1063124589 10 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124589 10:3127432-3127454 TGACAGTAATTCCCCACCTCAGG No data
1063124588_1063124594 21 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124594 10:3127443-3127465 CCCCACCTCAGGGTGGGCTGCGG No data
1063124588_1063124592 15 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124592 10:3127437-3127459 GTAATTCCCCACCTCAGGGTGGG No data
1063124588_1063124598 23 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124598 10:3127445-3127467 CCACCTCAGGGTGGGCTGCGGGG No data
1063124588_1063124591 14 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124591 10:3127436-3127458 AGTAATTCCCCACCTCAGGGTGG No data
1063124588_1063124596 22 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124596 10:3127444-3127466 CCCACCTCAGGGTGGGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063124588 Original CRISPR GAATGACATCAACCGCTTAA TGG (reversed) Intronic
901523463 1:9803846-9803868 CAATGACATCAGCCATTTAAAGG + Intronic
904391387 1:30188547-30188569 GAAGGACACCAACGGCTGAAGGG - Intergenic
904394649 1:30211212-30211234 GAATGACATCAATAACATAAAGG - Intergenic
908783941 1:67716730-67716752 GAATAACAGCAACCCCTGAATGG - Intronic
916732293 1:167577103-167577125 GAATGGGCACAACCGCTTAATGG - Intergenic
918886885 1:190205282-190205304 GAACCATATCAACCGCTTACTGG - Intronic
924113269 1:240721369-240721391 GGCTGACATCAACTCCTTAAAGG - Intergenic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1068048886 10:51923674-51923696 GAATGACAGCAACCTTATAAGGG - Intronic
1072927553 10:99629752-99629774 GAATGAGAGTAACTGCTTAATGG + Intergenic
1075952813 10:126496747-126496769 GAAACACATCAAGCACTTAAGGG + Intronic
1087180787 11:95140437-95140459 CACTGACATCAGCTGCTTAAAGG + Intergenic
1092937526 12:13377946-13377968 GAATGACATCATAGGGTTAACGG + Intronic
1100834178 12:98550493-98550515 GAATGACATTAAGCGCTCCAAGG + Intergenic
1101543960 12:105692471-105692493 GAATGACATCGATAACTTAATGG + Intergenic
1113014573 13:105814041-105814063 TAATGAGATCAGCCCCTTAATGG - Intergenic
1123141583 14:106084609-106084631 GAATGACTTAACCTGCTTAAAGG - Intergenic
1126947690 15:53842004-53842026 AAAAGACATCAACATCTTAATGG - Intergenic
1127577651 15:60307705-60307727 AAATGAAATCTACAGCTTAAGGG + Intergenic
1142313744 16:89330111-89330133 GAATGACATTAAACATTTAAAGG + Intronic
1145228788 17:21154800-21154822 GAATGACAGCAACAGTGTAAGGG + Intronic
1147757489 17:42778657-42778679 GAATGACACCATCTGCTTCAGGG - Intronic
1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG + Exonic
1154317776 18:13319055-13319077 GAATGACCTCACCCACTAAATGG - Intronic
1155620853 18:27777836-27777858 GAAGCACACCAACCGCATAATGG + Intergenic
926174633 2:10579645-10579667 GAATGACATGAACAGGTTGAGGG - Intronic
928466789 2:31529673-31529695 GAGTGGCCTCAACTGCTTAACGG + Intronic
929202232 2:39247884-39247906 GAATGAGATCAACCGGTTATGGG - Intergenic
932334439 2:70922013-70922035 GAATGACATCATCTGCTTCTTGG - Intronic
940699036 2:157018977-157018999 GAATGACAGCAAACTCTTATTGG - Intergenic
944824392 2:203467088-203467110 GAAAGATATAAACAGCTTAAGGG + Intronic
1174852620 20:54009285-54009307 GAGTGAAATCAACAGCATAATGG + Intronic
956441620 3:69286348-69286370 GTATGACATCAATCGCATAAAGG + Intronic
959328688 3:104973478-104973500 GAATTAAATCAAGCACTTAAAGG - Intergenic
963217656 3:142767791-142767813 GAATGACATCTTTTGCTTAATGG + Intronic
964555295 3:157930565-157930587 GAATGACATAACCCCGTTAAAGG - Intergenic
966275552 3:178161734-178161756 GAATGACAGCAATCACATAAGGG + Intergenic
966920290 3:184606707-184606729 AAATGACATCAATGGGTTAATGG + Intronic
974846866 4:67362200-67362222 GATTGACATAAGCCGCTTATTGG + Intergenic
977376504 4:96211956-96211978 GAATGAGATCAACAGAGTAATGG + Intergenic
980655499 4:135778481-135778503 GAATGACATCAAGCATTTAGTGG + Intergenic
982607335 4:157531276-157531298 GAAATACATCAACAGCTAAAAGG - Intergenic
985075206 4:186207319-186207341 GAATGACATGAACCCCTCAGGGG + Intronic
991936424 5:71806110-71806132 GAATCACAACAAGCGCTTAATGG - Intergenic
996746702 5:126852352-126852374 TAATGAGATCAGCCCCTTAACGG + Intergenic
1009873593 6:69477956-69477978 CAATCACATCAACAGCCTAAAGG + Intergenic
1011758146 6:90527130-90527152 TAATCACATCAACAGATTAAAGG + Intronic
1015893434 6:137992305-137992327 GTATGACAAAAACCGCTTACAGG + Intergenic
1023447857 7:40250798-40250820 AAATGACTTCAACATCTTAAGGG - Intronic
1035890117 8:3334154-3334176 AAATGACATCAACCTTTTCAAGG + Intronic
1038275043 8:26114367-26114389 CAATGACATCAACTCCTTGAGGG - Intergenic
1039225326 8:35382261-35382283 AAATGTCATCAACCGCTGTAGGG - Intronic
1039667945 8:39556828-39556850 GAATGTGAGCAACTGCTTAATGG - Intergenic
1041339442 8:56826999-56827021 GAATGACATCAATGACATAAGGG + Intergenic
1047860225 8:128957865-128957887 GAAGGACATCAACCATTTCACGG - Intergenic
1049187860 8:141268111-141268133 GAATGTCATTCACCGCTAAACGG + Intronic
1056644534 9:88399330-88399352 GCCTGACAGAAACCGCTTAACGG - Intronic
1058862925 9:109134989-109135011 AAATGACATCAAGTGCATAATGG - Exonic
1187769011 X:22674693-22674715 GAATGTAATCAACCACTTACTGG + Intergenic
1192131112 X:68551530-68551552 GAATGTCCTCAACCGATAAAGGG + Intergenic
1192855419 X:75005099-75005121 GAATGACATCAAGCAATTCATGG + Intergenic
1193569308 X:83122799-83122821 GAATGACTTCAAGAGCTTAAAGG + Intergenic
1199739933 X:150725662-150725684 GGATGACAACAACAGCATAAAGG - Intronic