ID: 1063124590

View in Genome Browser
Species Human (GRCh38)
Location 10:3127433-3127455
Sequence GACAGTAATTCCCCACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063124586_1063124590 27 Left 1063124586 10:3127383-3127405 CCGCAGAATTCTTTTGCCATTAA 0: 1
1: 0
2: 3
3: 29
4: 291
Right 1063124590 10:3127433-3127455 GACAGTAATTCCCCACCTCAGGG No data
1063124588_1063124590 11 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124590 10:3127433-3127455 GACAGTAATTCCCCACCTCAGGG No data
1063124585_1063124590 28 Left 1063124585 10:3127382-3127404 CCCGCAGAATTCTTTTGCCATTA 0: 1
1: 0
2: 0
3: 14
4: 199
Right 1063124590 10:3127433-3127455 GACAGTAATTCCCCACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063124590 Original CRISPR GACAGTAATTCCCCACCTCA GGG Intronic
No off target data available for this crispr