ID: 1063124594

View in Genome Browser
Species Human (GRCh38)
Location 10:3127443-3127465
Sequence CCCCACCTCAGGGTGGGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063124588_1063124594 21 Left 1063124588 10:3127399-3127421 CCATTAAGCGGTTGATGTCATTC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1063124594 10:3127443-3127465 CCCCACCTCAGGGTGGGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063124594 Original CRISPR CCCCACCTCAGGGTGGGCTG CGG Intronic
No off target data available for this crispr