ID: 1063124669

View in Genome Browser
Species Human (GRCh38)
Location 10:3127958-3127980
Sequence ACCCAAGTTTAACACCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063124669_1063124671 -5 Left 1063124669 10:3127958-3127980 CCCAATGGGTGTTAAACTTGGGT No data
Right 1063124671 10:3127976-3127998 TGGGTGCACAGACTCTCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063124669 Original CRISPR ACCCAAGTTTAACACCCATT GGG (reversed) Intronic