ID: 1063127278

View in Genome Browser
Species Human (GRCh38)
Location 10:3146580-3146602
Sequence GGATTCTCAGGACATGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063127270_1063127278 -2 Left 1063127270 10:3146559-3146581 CCGCCCTGTAGAATCTGCCAGGG No data
Right 1063127278 10:3146580-3146602 GGATTCTCAGGACATGACTGGGG No data
1063127272_1063127278 -5 Left 1063127272 10:3146562-3146584 CCCTGTAGAATCTGCCAGGGATT No data
Right 1063127278 10:3146580-3146602 GGATTCTCAGGACATGACTGGGG No data
1063127268_1063127278 5 Left 1063127268 10:3146552-3146574 CCACAGACCGCCCTGTAGAATCT No data
Right 1063127278 10:3146580-3146602 GGATTCTCAGGACATGACTGGGG No data
1063127267_1063127278 6 Left 1063127267 10:3146551-3146573 CCCACAGACCGCCCTGTAGAATC No data
Right 1063127278 10:3146580-3146602 GGATTCTCAGGACATGACTGGGG No data
1063127266_1063127278 9 Left 1063127266 10:3146548-3146570 CCACCCACAGACCGCCCTGTAGA No data
Right 1063127278 10:3146580-3146602 GGATTCTCAGGACATGACTGGGG No data
1063127265_1063127278 16 Left 1063127265 10:3146541-3146563 CCTCTGGCCACCCACAGACCGCC No data
Right 1063127278 10:3146580-3146602 GGATTCTCAGGACATGACTGGGG No data
1063127264_1063127278 26 Left 1063127264 10:3146531-3146553 CCAGGCTTCACCTCTGGCCACCC No data
Right 1063127278 10:3146580-3146602 GGATTCTCAGGACATGACTGGGG No data
1063127273_1063127278 -6 Left 1063127273 10:3146563-3146585 CCTGTAGAATCTGCCAGGGATTC No data
Right 1063127278 10:3146580-3146602 GGATTCTCAGGACATGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063127278 Original CRISPR GGATTCTCAGGACATGACTG GGG Intronic