ID: 1063127820

View in Genome Browser
Species Human (GRCh38)
Location 10:3150887-3150909
Sequence CAGGGTAAACATTAGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063127818_1063127820 -8 Left 1063127818 10:3150872-3150894 CCTCTATGCTGATGGCAGGGTAA 0: 1
1: 0
2: 1
3: 5
4: 123
Right 1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG No data
1063127813_1063127820 2 Left 1063127813 10:3150862-3150884 CCCTCTGCTTCCTCTATGCTGAT 0: 1
1: 0
2: 4
3: 27
4: 359
Right 1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG No data
1063127814_1063127820 1 Left 1063127814 10:3150863-3150885 CCTCTGCTTCCTCTATGCTGATG 0: 1
1: 0
2: 1
3: 50
4: 350
Right 1063127820 10:3150887-3150909 CAGGGTAAACATTAGGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063127820 Original CRISPR CAGGGTAAACATTAGGAAAA AGG Intronic
No off target data available for this crispr