ID: 1063128211

View in Genome Browser
Species Human (GRCh38)
Location 10:3154044-3154066
Sequence CTGGAGGCCCAGTCGGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063128211_1063128219 23 Left 1063128211 10:3154044-3154066 CCACACCCCGACTGGGCCTCCAG No data
Right 1063128219 10:3154090-3154112 CCTGCAGCTTTGCCACATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063128211 Original CRISPR CTGGAGGCCCAGTCGGGGTG TGG (reversed) Intronic
No off target data available for this crispr