ID: 1063130431

View in Genome Browser
Species Human (GRCh38)
Location 10:3172948-3172970
Sequence GCGGTGCGGACGGAGATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063130423_1063130431 2 Left 1063130423 10:3172923-3172945 CCACTGCTCTGGGACGGGCGGGA 0: 1
1: 0
2: 0
3: 16
4: 271
Right 1063130431 10:3172948-3172970 GCGGTGCGGACGGAGATGGGCGG 0: 1
1: 0
2: 0
3: 17
4: 183
1063130420_1063130431 5 Left 1063130420 10:3172920-3172942 CCTCCACTGCTCTGGGACGGGCG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1063130431 10:3172948-3172970 GCGGTGCGGACGGAGATGGGCGG 0: 1
1: 0
2: 0
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063130431 Original CRISPR GCGGTGCGGACGGAGATGGG CGG Intergenic
901448519 1:9322606-9322628 TCGTTGCGGACAGAGGTGGGAGG + Intronic
901735615 1:11310374-11310396 CAGGTGGGGAGGGAGATGGGTGG + Intergenic
902571857 1:17352183-17352205 GCGGTCAGGGAGGAGATGGGAGG + Intronic
903925787 1:26829501-26829523 GCTGTGCGGATGGACAGGGGAGG - Intronic
905379854 1:37554086-37554108 GTGGTCCGGACGGCGGTGGGCGG + Exonic
905584423 1:39105609-39105631 GCGGTGCGGGCGGCCATGGCCGG + Intronic
905793492 1:40802543-40802565 GCGGGGCTTACGGAAATGGGCGG - Intronic
906692654 1:47802751-47802773 GGGGTGTGCCCGGAGATGGGCGG - Intronic
907404114 1:54243253-54243275 GCGGGGCCGAGGGAGTTGGGTGG + Exonic
907908985 1:58810679-58810701 GCAGTGGGGAGGGAGATGGGTGG + Intergenic
910459483 1:87433694-87433716 GGGGTGGGGACGGAGAGGGGAGG + Intergenic
915541883 1:156572572-156572594 GCGGTGCCGACGGTGAGGGGCGG - Intronic
919724123 1:200871143-200871165 GCAGTGGGGACAGAAATGGGAGG - Intergenic
920180475 1:204129295-204129317 GAGGGGCGGGCGGAGAGGGGAGG - Intergenic
920708051 1:208269183-208269205 GGGGTGAGGAGGGAGAAGGGAGG + Intergenic
922254881 1:223885254-223885276 GCGGGGCGGAGGGAGCGGGGAGG - Intergenic
924328678 1:242921188-242921210 GAGGGGAGGAGGGAGATGGGAGG + Intergenic
1063130431 10:3172948-3172970 GCGGTGCGGACGGAGATGGGCGG + Intergenic
1064011268 10:11738378-11738400 GTGGTGGGGTGGGAGATGGGAGG - Intergenic
1067057564 10:43061252-43061274 CCAGTGAGGACGGAGATGGGGGG - Intergenic
1067764084 10:49072192-49072214 GCGGTGCAGCCTGACATGGGGGG + Intronic
1073207431 10:101776296-101776318 GCGGGGCGGCCGGGGAGGGGCGG + Intronic
1076035408 10:127195791-127195813 CCGGTGCGGTCGCAGGTGGGGGG - Intronic
1077385791 11:2269007-2269029 GCGGTGCGGGGGGTGGTGGGTGG + Exonic
1078965845 11:16341114-16341136 GGGGTGCAGAGGCAGATGGGAGG + Exonic
1079137591 11:17784751-17784773 GCAGTGCGGAGGGAGGAGGGAGG - Intergenic
1081575994 11:44318890-44318912 TCGGTGCGCAGGGAGATGGAGGG + Intergenic
1084471904 11:69367212-69367234 GCGGGGCGGAGGGTGGTGGGGGG + Intronic
1084888669 11:72225652-72225674 GTGGTGGGGGCGGTGATGGGTGG + Intronic
1085416564 11:76322247-76322269 GCGGGCGGGACGGAGAAGGGAGG + Intergenic
1089785409 11:120903703-120903725 GCGGTGGGGAAGGAGCTTGGAGG + Intronic
1096110039 12:49023121-49023143 GGGGTGTGGAGGGAGATGGGGGG + Intronic
1096642603 12:53006361-53006383 GAGGTGAGGACGGAGACAGGAGG - Exonic
1097174422 12:57134624-57134646 GAGGTGGAGGCGGAGATGGGCGG - Intronic
1097190244 12:57216345-57216367 GCGATGCTGACGGGGATGGATGG - Intergenic
1102084366 12:110124223-110124245 GCGGAGCGGACGGGGCGGGGCGG - Intergenic
1103563362 12:121803923-121803945 GCGGCGAGGAAGGAGAGGGGAGG + Intergenic
1105698575 13:22915687-22915709 GCGGTGCAGACAGAGCAGGGGGG - Intergenic
1106323685 13:28666893-28666915 GTGGTGCGGTGGGGGATGGGGGG + Intronic
1110318619 13:74135608-74135630 GCGCGGCGGACGGAGGCGGGAGG + Intergenic
1114548856 14:23522071-23522093 GCGTTGGTGATGGAGATGGGTGG + Exonic
1116657799 14:47674094-47674116 GCGGCGGGGGCGGAGAGGGGTGG + Intronic
1118718251 14:68575580-68575602 GCGTTGGGGAGGGAGAGGGGAGG - Intronic
1120024384 14:79566359-79566381 GAGGTGAGGAGGGAGTTGGGAGG - Intronic
1123485313 15:20730580-20730602 GCGGTGGGGATGGAGAGGAGAGG - Intergenic
1123541801 15:21299629-21299651 GCGGTGGGGATGGAGAGGAGAGG - Intergenic
1123587063 15:21770163-21770185 GCAGTGCAGTCGGAGATGGATGG + Intergenic
1123623701 15:22212728-22212750 GCAGTGCAGTCGGAGATGGATGG + Intergenic
1125742089 15:41972415-41972437 GCGGTGCAGACGGTGACGGGCGG - Exonic
1126345114 15:47685486-47685508 GGGGTGAGGAAGGAGATGGGAGG + Intronic
1129823727 15:78620900-78620922 GCCGTGCGGGCGGAGACGCGCGG + Exonic
1131111753 15:89768790-89768812 GGGGTGGGGACGGGGGTGGGGGG - Intronic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1131641826 15:94301312-94301334 CCGGTGAGGAGGGAGCTGGGTGG - Intronic
1132359542 15:101201110-101201132 GCGGTGCGGGGGGAGGTGGTCGG + Intronic
1202950116 15_KI270727v1_random:26771-26793 GCGGTGGGGATGGAGAGGAGAGG - Intergenic
1132478499 16:154139-154161 GCGGTGCGGGCGGGGCGGGGCGG + Intronic
1132480570 16:164698-164720 GCGGTGCGGGCGGGGCGGGGCGG + Intronic
1132549854 16:549888-549910 GCGGAGCGGTGGGAGATGTGGGG + Intronic
1132685111 16:1158916-1158938 GCGGTGCGGGCTGAGCGGGGGGG - Intronic
1133021051 16:2967136-2967158 GCGGCCCGGACGGCGGTGGGCGG - Exonic
1134815774 16:17204537-17204559 GAGATGCGGATGGGGATGGGGGG + Intronic
1138085193 16:54127074-54127096 ATGGTGCGGACAGAGATGGCAGG - Intergenic
1138372440 16:56538018-56538040 GTGGTGAGGACTGGGATGGGAGG - Intergenic
1138698249 16:58835693-58835715 GCAATGTGGACGGAGCTGGGAGG - Intergenic
1139442275 16:66974269-66974291 GAGGTGCGGAGGGAGAGGGGCGG + Exonic
1139819253 16:69707543-69707565 GGGGTAGGGACTGAGATGGGAGG - Intronic
1140206821 16:72940016-72940038 GCAGTGGGGACTGAGGTGGGAGG - Intronic
1141121077 16:81357248-81357270 GCGGGGTGGAGGGAGAGGGGAGG - Intronic
1141837677 16:86553418-86553440 GCGGTGTGGAGGGAGAGGCGCGG + Intronic
1142850403 17:2701854-2701876 GCGGGGAGCACGGAGGTGGGGGG - Intronic
1143503540 17:7352059-7352081 GCGGCCCGGGCGGAGGTGGGAGG - Intronic
1145765760 17:27457143-27457165 GGGGTGGGGGCGGAGAAGGGGGG - Intronic
1146182949 17:30709102-30709124 GCGGAGCTGGCGGAGAGGGGCGG - Intergenic
1147339644 17:39745888-39745910 GTGGTGGGGAAGGACATGGGCGG - Intronic
1147364914 17:39953147-39953169 GCGGTGAGGGCGGGGCTGGGTGG + Intergenic
1147429493 17:40362865-40362887 GCGGTGCGGGCGGAGGTGGCGGG + Intronic
1148157146 17:45431009-45431031 GCGGTGCGGGCCGGGCTGGGCGG - Intronic
1148472600 17:47904563-47904585 GCGGAGTGGGGGGAGATGGGAGG + Intronic
1148791498 17:50175739-50175761 GTGGTGTGGACAGAGAAGGGAGG - Exonic
1151669866 17:75566112-75566134 GGGGTGCAGACTGAGCTGGGAGG + Intronic
1151983760 17:77529038-77529060 GCGGGGCCGTCGCAGATGGGCGG + Intergenic
1152599200 17:81253033-81253055 GGGGTGCGGATGGGGAAGGGCGG - Intronic
1152751783 17:82065683-82065705 GCGGCGAGGCCGGAGAGGGGCGG - Intronic
1152855796 17:82664052-82664074 GCTGTGCCGACGGTGGTGGGGGG + Intronic
1157609821 18:48949460-48949482 GGGGTGCAGAGGGAGGTGGGGGG - Intronic
1158118583 18:54024183-54024205 GAGGTGGGGACGGGGTTGGGGGG + Intergenic
1159406810 18:68013585-68013607 GCGGGGCGGGGGGAGAGGGGAGG + Intergenic
1159890016 18:73944133-73944155 GCCGTGGGGAAGGAGGTGGGAGG - Intergenic
1161016828 19:1987428-1987450 TCGGGGATGACGGAGATGGGGGG - Intronic
1161496877 19:4591388-4591410 GGGGTGGGGACGGGGATGGGGGG - Intergenic
1161741993 19:6026949-6026971 GAGGTGGGGAGGGAGGTGGGCGG + Intronic
1162802496 19:13118857-13118879 GCGGCGCGGCCGGAGGGGGGCGG + Intronic
1165215119 19:34265508-34265530 GTGGTGGGCACGGAAATGGGAGG + Intronic
1165454718 19:35903901-35903923 AAGGTGAGGGCGGAGATGGGCGG + Exonic
1166126346 19:40717283-40717305 GCGGGGCGGCCGGAGGGGGGCGG + Exonic
1168332536 19:55578689-55578711 GCGGTGCTGGCGGAGGTAGGAGG + Exonic
925871808 2:8278229-8278251 GGGGTGCGGGAGGAGGTGGGAGG - Intergenic
926437701 2:12854441-12854463 GAGGTGTGGAGGGAGAGGGGTGG - Intergenic
927414765 2:22867621-22867643 GCTGTGCAGACAAAGATGGGAGG + Intergenic
927596552 2:24402849-24402871 GAGGTGCGGAGGGAGAGGCGCGG + Intergenic
927842278 2:26453395-26453417 GCAGAGCAGACGGAGATGGAGGG + Exonic
929501415 2:42494075-42494097 GCGGCGCGGAGGGAGGTGAGCGG - Exonic
930420922 2:51151991-51152013 GAGGTGTGGAGGGAGATGTGTGG - Intergenic
935848958 2:107198132-107198154 GCAGTGTGGAGGGAGATGGCAGG + Intergenic
938405670 2:131031914-131031936 GTGGTGGGGAGGGAGCTGGGTGG - Intronic
939969655 2:148644957-148644979 GCGGGGCGGGCGGGGAGGGGGGG - Intronic
943947904 2:194090763-194090785 GAGGTGTGGAGGGAGATGCGTGG - Intergenic
944441999 2:199752218-199752240 GGGGTGGGGAGGGAGAGGGGAGG - Intergenic
946386673 2:219387981-219388003 GCGGGGCTGACCGAGGTGGGCGG - Exonic
947718251 2:232352459-232352481 GCGGGGCGGGCGAAGAAGGGTGG - Intergenic
947741751 2:232487900-232487922 GCGGGGCGGGCGGAGGAGGGTGG - Intergenic
949027901 2:241774894-241774916 GGGGTGCGGACGGGGCTGGCTGG - Intergenic
1169332978 20:4730929-4730951 GTGGTGGGGAGGGAGAGGGGAGG + Intergenic
1172444500 20:34986014-34986036 GCGATGCGGAGGGAGAGAGGTGG - Intronic
1175545517 20:59775454-59775476 GCGGTGGGTACTGTGATGGGTGG + Intronic
1179836683 21:44039232-44039254 GACGGGCTGACGGAGATGGGTGG - Intronic
1180156685 21:45981654-45981676 GCGGGGCGGGAGGAGAGGGGAGG - Intergenic
1180231024 21:46426811-46426833 AGGGTGGGCACGGAGATGGGAGG - Intronic
1183456732 22:37927055-37927077 GCAGTGCGGAGGCAGAGGGGAGG - Intronic
1183539724 22:38423095-38423117 GCGGCGCTGACGGAGCGGGGTGG - Intergenic
1183685659 22:39359998-39360020 GAGGTGCGGAGGGAGACAGGAGG - Intronic
1183727098 22:39596175-39596197 GCAGGGCGGAGGGAGATGGGGGG + Intronic
1183727118 22:39596234-39596256 GCAGGGTGGAGGGAGATGGGGGG + Intronic
1183727143 22:39596298-39596320 GCAGGACGGAGGGAGATGGGGGG + Intronic
1183727174 22:39596389-39596411 GCAGGGCGGAGAGAGATGGGGGG + Intronic
1183727185 22:39596412-39596434 GCAGGGCGGAGGGAGATGGGGGG + Intronic
1183727195 22:39596435-39596457 GCAGGGCGGAGGGAGATCGGGGG + Intronic
1183994213 22:41620919-41620941 GCGAAGCGGAGGGAGAGGGGGGG + Exonic
1185163095 22:49241338-49241360 GGGGTGGGGACGGAGTTGCGAGG - Intergenic
1185266412 22:49906528-49906550 GCGGGGCAGTCGGAGCTGGGGGG + Intronic
1185384567 22:50525943-50525965 GCCGCGCGGCCGGAGCTGGGCGG + Intronic
950487338 3:13281521-13281543 GCGGTGCGGGTGGGGCTGGGGGG - Intergenic
951541905 3:23789892-23789914 GCGGAGAGGACAGAGAAGGGGGG + Intergenic
953150416 3:40319474-40319496 GTGGTGCTGAGGGAGATGGGTGG - Intergenic
953719930 3:45346570-45346592 GGGGTAGGGATGGAGATGGGGGG - Intergenic
954250824 3:49365946-49365968 TGGGTGGGGACTGAGATGGGAGG + Intronic
957386410 3:79502246-79502268 GAGGTGTGGAGGGAGATGCGCGG + Intronic
961680956 3:128599712-128599734 GAGGTGGGGGCTGAGATGGGAGG + Intergenic
962321720 3:134396140-134396162 GGGGTACGGACAGAGCTGGGAGG - Intergenic
963442321 3:145355857-145355879 GGGATGGGGAAGGAGATGGGAGG + Intergenic
965596751 3:170418691-170418713 GCGCTGCGGACGGGGTGGGGCGG + Intergenic
965597016 3:170419808-170419830 GCTGCGCGGACGGAGCTAGGAGG - Intronic
968647812 4:1749027-1749049 GCGGTGGGGAGGGAGAGCGGTGG - Intergenic
968879757 4:3292953-3292975 GGGGCGGGGACGGAGAGGGGCGG - Intergenic
969108908 4:4829099-4829121 GCTGTGGGGATGGAGAGGGGAGG - Intergenic
969503690 4:7570590-7570612 GCGGTGCCCATGGAAATGGGAGG + Intronic
970996680 4:22275553-22275575 GGGGTGGGGAGGGAGATGTGGGG + Intergenic
981136905 4:141220840-141220862 GCGGAGCGAACAGAGGTGGGCGG + Intergenic
984811416 4:183798429-183798451 GCGGGCCGGGCGGAGGTGGGCGG + Intergenic
986255591 5:6100431-6100453 GCGGTGTAGAGGTAGATGGGTGG - Intergenic
988509701 5:31854899-31854921 GCGGCGCGGAGGGAGGAGGGGGG + Intronic
990451367 5:55934033-55934055 GTGGTGGGGAGGGAGATGAGGGG + Intergenic
991587505 5:68215630-68215652 GCCGTGCGGACGGAAAGGGGCGG + Intergenic
998385188 5:141753405-141753427 GCGGTGCGGAGGGAGAGAGACGG + Intergenic
999378084 5:151100958-151100980 GCGGCCTGGATGGAGATGGGTGG + Intronic
999748918 5:154611680-154611702 GCGGGGCGGACGGACAGGGGCGG - Intergenic
1000209924 5:159099381-159099403 GCGGTGCGGACGTGGATGCAGGG - Exonic
1002795465 6:467844-467866 GGGGTGGGGACGGAGGTGTGTGG - Intergenic
1003956638 6:11171064-11171086 GAGGTGTGGAGGGAGAGGGGCGG + Intergenic
1006797679 6:36741870-36741892 GAGGATGGGACGGAGATGGGGGG + Exonic
1007350581 6:41270810-41270832 GTGGTGGGGGCTGAGATGGGAGG - Intronic
1008542072 6:52554147-52554169 GCGGTGGGGACAGGGCTGGGTGG - Intronic
1008932602 6:56955406-56955428 GCGGGGCGCAGGGAGGTGGGAGG - Exonic
1011686892 6:89830597-89830619 GAGGCGCTGAGGGAGATGGGGGG - Intronic
1013217368 6:108040013-108040035 GGGGTGGGGAGGGAGGTGGGTGG + Intergenic
1015519347 6:134115125-134115147 GTGGTGAGGACGCAGGTGGGCGG + Intergenic
1018980918 6:168601221-168601243 GCGGGCCAGACGGTGATGGGTGG - Intronic
1019163280 6:170083056-170083078 GTGGTGCGGAGGGAGTGGGGGGG - Intergenic
1020083057 7:5296735-5296757 GCGGGGCCGGCGGTGATGGGCGG + Intronic
1022578365 7:31521830-31521852 GTGGTGGGGGCTGAGATGGGAGG - Intronic
1024555403 7:50599171-50599193 TGGGTGGGGACGGGGATGGGAGG + Intronic
1026195952 7:68173934-68173956 GCAGTGGGGAAGGTGATGGGGGG - Intergenic
1026595877 7:71733558-71733580 GCGATGCGGATGGGGATGAGGGG + Intergenic
1029162612 7:98563377-98563399 GCTGTGGGGGCAGAGATGGGTGG + Intergenic
1031968317 7:128044615-128044637 GGGGTGGGGGGGGAGATGGGAGG - Intronic
1032474069 7:132200367-132200389 GCGGTGGGGACTGGGAAGGGAGG + Intronic
1034100394 7:148445595-148445617 GAGGTGCGGAGGGAGAGGTGCGG - Intergenic
1034268874 7:149793802-149793824 GCAGGGCGGACGGAGAGGGAGGG - Intergenic
1039772681 8:40703587-40703609 GCAGGGAGGAGGGAGATGGGAGG + Intronic
1039798476 8:40934964-40934986 GCAGTGTGCACGGAGGTGGGAGG + Intergenic
1040439808 8:47429360-47429382 GCTGTGCACACGGAGGTGGGGGG - Intronic
1044441608 8:92230779-92230801 GGGGTGTGGAGGGAGAGGGGCGG + Intergenic
1044551782 8:93520609-93520631 GGGGGGCGGAGGGAGAGGGGAGG + Intergenic
1049762234 8:144336772-144336794 CCGGCGCGGGCGGAGAGGGGCGG + Intergenic
1054172662 9:61855818-61855840 GGGGTGCGGGTCGAGATGGGGGG - Intergenic
1054664878 9:67724983-67725005 GGGGTGCGGGTCGAGATGGGGGG + Intergenic
1056764702 9:89437544-89437566 GCGGTGCGCCCTGAGAGGGGAGG + Intronic
1060547282 9:124468919-124468941 GCACTGCGGATGGAGAGGGGAGG - Intronic
1060916906 9:127397329-127397351 GCGGAGCGGACGCGGAGGGGCGG - Intronic
1061253621 9:129440874-129440896 GTGGTGCGGACGGGGTTGGGGGG - Intergenic
1062363299 9:136197546-136197568 GCGGGGCGGCGGGGGATGGGGGG + Exonic
1062384724 9:136304667-136304689 GGGGTGGGGAAGGAGCTGGGAGG - Intronic
1186422857 X:9440107-9440129 GCGGGGCGGGGGGAGGTGGGGGG - Intergenic
1194204429 X:90995412-90995434 GAGGTGCGGAGGGAGAGGTGCGG + Intergenic
1196646744 X:118126240-118126262 GGGGTGAGGAGTGAGATGGGAGG - Intergenic
1196860905 X:120026157-120026179 GAGGTGTGGAGGGAGATGCGCGG - Intergenic
1200136250 X:153876084-153876106 GGGGTGCGGATGGGGAGGGGAGG - Intronic
1200258503 X:154598997-154599019 GGGGTGGGGGCGGAGGTGGGGGG - Intergenic
1200550270 Y:4570853-4570875 GAGGTGCGGAGGGAGAGGTGCGG + Intergenic
1201729968 Y:17192628-17192650 GAGGTGTGGATGGAGATGCGTGG - Intergenic