ID: 1063132507

View in Genome Browser
Species Human (GRCh38)
Location 10:3190328-3190350
Sequence CTGTATCAGCAGATGGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063132505_1063132507 -3 Left 1063132505 10:3190308-3190330 CCATCTATCAAAGGTCAGTGCTG No data
Right 1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG No data
1063132503_1063132507 15 Left 1063132503 10:3190290-3190312 CCATGTTGGCAAATTGAACCATC No data
Right 1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG No data
1063132502_1063132507 23 Left 1063132502 10:3190282-3190304 CCTGCACTCCATGTTGGCAAATT No data
Right 1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG No data
1063132501_1063132507 24 Left 1063132501 10:3190281-3190303 CCCTGCACTCCATGTTGGCAAAT No data
Right 1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063132507 Original CRISPR CTGTATCAGCAGATGGAACG TGG Intergenic
No off target data available for this crispr