ID: 1063134158

View in Genome Browser
Species Human (GRCh38)
Location 10:3201853-3201875
Sequence CTTTCTGAGGGGCTGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063134149_1063134158 1 Left 1063134149 10:3201829-3201851 CCTTTACTTCTTCAGCGGGACTT No data
Right 1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG No data
1063134145_1063134158 10 Left 1063134145 10:3201820-3201842 CCTGCAGTCCCTTTACTTCTTCA No data
Right 1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG No data
1063134148_1063134158 2 Left 1063134148 10:3201828-3201850 CCCTTTACTTCTTCAGCGGGACT No data
Right 1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063134158 Original CRISPR CTTTCTGAGGGGCTGGGGGA GGG Intergenic
No off target data available for this crispr