ID: 1063134980

View in Genome Browser
Species Human (GRCh38)
Location 10:3208554-3208576
Sequence GGTCCTGATGGCCGAGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063134976_1063134980 -5 Left 1063134976 10:3208536-3208558 CCTTTTCCCTGGTGAGAGGGTCC No data
Right 1063134980 10:3208554-3208576 GGTCCTGATGGCCGAGTGCCAGG No data
1063134971_1063134980 20 Left 1063134971 10:3208511-3208533 CCCACACTGCTCTGTGACAGGTC No data
Right 1063134980 10:3208554-3208576 GGTCCTGATGGCCGAGTGCCAGG No data
1063134972_1063134980 19 Left 1063134972 10:3208512-3208534 CCACACTGCTCTGTGACAGGTCT No data
Right 1063134980 10:3208554-3208576 GGTCCTGATGGCCGAGTGCCAGG No data
1063134970_1063134980 21 Left 1063134970 10:3208510-3208532 CCCCACACTGCTCTGTGACAGGT No data
Right 1063134980 10:3208554-3208576 GGTCCTGATGGCCGAGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063134980 Original CRISPR GGTCCTGATGGCCGAGTGCC AGG Intergenic
No off target data available for this crispr