ID: 1063137343

View in Genome Browser
Species Human (GRCh38)
Location 10:3229209-3229231
Sequence AAATAGAGGCTAGACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063137343_1063137353 20 Left 1063137343 10:3229209-3229231 CCTTCCCAGTCTAGCCTCTATTT No data
Right 1063137353 10:3229252-3229274 CCACAGCTTCCCTCTCCACCTGG No data
1063137343_1063137355 26 Left 1063137343 10:3229209-3229231 CCTTCCCAGTCTAGCCTCTATTT No data
Right 1063137355 10:3229258-3229280 CTTCCCTCTCCACCTGGGCACGG No data
1063137343_1063137354 21 Left 1063137343 10:3229209-3229231 CCTTCCCAGTCTAGCCTCTATTT No data
Right 1063137354 10:3229253-3229275 CACAGCTTCCCTCTCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063137343 Original CRISPR AAATAGAGGCTAGACTGGGA AGG (reversed) Intergenic
No off target data available for this crispr