ID: 1063138993

View in Genome Browser
Species Human (GRCh38)
Location 10:3240090-3240112
Sequence CTCTCTGTGGTGAACGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063138984_1063138993 -7 Left 1063138984 10:3240074-3240096 CCATCCCCCCAGTTTCCTCTCTG No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data
1063138977_1063138993 7 Left 1063138977 10:3240060-3240082 CCTTGTCCCCCCCTCCATCCCCC No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data
1063138975_1063138993 23 Left 1063138975 10:3240044-3240066 CCTGAAGGTGACCTGGCCTTGTC No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data
1063138978_1063138993 1 Left 1063138978 10:3240066-3240088 CCCCCCCTCCATCCCCCCAGTTT No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data
1063138976_1063138993 12 Left 1063138976 10:3240055-3240077 CCTGGCCTTGTCCCCCCCTCCAT No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data
1063138982_1063138993 -3 Left 1063138982 10:3240070-3240092 CCCTCCATCCCCCCAGTTTCCTC No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data
1063138983_1063138993 -4 Left 1063138983 10:3240071-3240093 CCTCCATCCCCCCAGTTTCCTCT No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data
1063138980_1063138993 -1 Left 1063138980 10:3240068-3240090 CCCCCTCCATCCCCCCAGTTTCC No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data
1063138979_1063138993 0 Left 1063138979 10:3240067-3240089 CCCCCCTCCATCCCCCCAGTTTC No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data
1063138981_1063138993 -2 Left 1063138981 10:3240069-3240091 CCCCTCCATCCCCCCAGTTTCCT No data
Right 1063138993 10:3240090-3240112 CTCTCTGTGGTGAACGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063138993 Original CRISPR CTCTCTGTGGTGAACGTGGT TGG Intergenic
No off target data available for this crispr