ID: 1063143679

View in Genome Browser
Species Human (GRCh38)
Location 10:3277026-3277048
Sequence GGAGTCTCGGGTGTTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063143675_1063143679 -2 Left 1063143675 10:3277005-3277027 CCTGCAGCTGACGCTGATGTCGG No data
Right 1063143679 10:3277026-3277048 GGAGTCTCGGGTGTTCCTTCTGG No data
1063143672_1063143679 7 Left 1063143672 10:3276996-3277018 CCGGGAGCCCCTGCAGCTGACGC No data
Right 1063143679 10:3277026-3277048 GGAGTCTCGGGTGTTCCTTCTGG No data
1063143673_1063143679 0 Left 1063143673 10:3277003-3277025 CCCCTGCAGCTGACGCTGATGTC No data
Right 1063143679 10:3277026-3277048 GGAGTCTCGGGTGTTCCTTCTGG No data
1063143674_1063143679 -1 Left 1063143674 10:3277004-3277026 CCCTGCAGCTGACGCTGATGTCG No data
Right 1063143679 10:3277026-3277048 GGAGTCTCGGGTGTTCCTTCTGG No data
1063143671_1063143679 11 Left 1063143671 10:3276992-3277014 CCTTCCGGGAGCCCCTGCAGCTG No data
Right 1063143679 10:3277026-3277048 GGAGTCTCGGGTGTTCCTTCTGG No data
1063143670_1063143679 17 Left 1063143670 10:3276986-3277008 CCTTGTCCTTCCGGGAGCCCCTG No data
Right 1063143679 10:3277026-3277048 GGAGTCTCGGGTGTTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063143679 Original CRISPR GGAGTCTCGGGTGTTCCTTC TGG Intergenic
No off target data available for this crispr