ID: 1063147937

View in Genome Browser
Species Human (GRCh38)
Location 10:3313472-3313494
Sequence TGTCCTGTGCTCACACATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063147937_1063147942 8 Left 1063147937 10:3313472-3313494 CCCCAATGTGTGAGCACAGGACA No data
Right 1063147942 10:3313503-3313525 CCCAGCTTGCCACTCAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063147937 Original CRISPR TGTCCTGTGCTCACACATTG GGG (reversed) Intergenic
No off target data available for this crispr