ID: 1063149065

View in Genome Browser
Species Human (GRCh38)
Location 10:3320528-3320550
Sequence GCTCCTTGGACCCCACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063149065_1063149073 7 Left 1063149065 10:3320528-3320550 CCAGACTGTGGGGTCCAAGGAGC No data
Right 1063149073 10:3320558-3320580 GGAATTAGGGTGGGCTCAGGAGG No data
1063149065_1063149074 14 Left 1063149065 10:3320528-3320550 CCAGACTGTGGGGTCCAAGGAGC No data
Right 1063149074 10:3320565-3320587 GGGTGGGCTCAGGAGGCTTCAGG No data
1063149065_1063149075 30 Left 1063149065 10:3320528-3320550 CCAGACTGTGGGGTCCAAGGAGC No data
Right 1063149075 10:3320581-3320603 CTTCAGGAAGCTGCGCAAAGAGG No data
1063149065_1063149068 -7 Left 1063149065 10:3320528-3320550 CCAGACTGTGGGGTCCAAGGAGC No data
Right 1063149068 10:3320544-3320566 AAGGAGCTGTCTGTGGAATTAGG No data
1063149065_1063149069 -6 Left 1063149065 10:3320528-3320550 CCAGACTGTGGGGTCCAAGGAGC No data
Right 1063149069 10:3320545-3320567 AGGAGCTGTCTGTGGAATTAGGG No data
1063149065_1063149071 -2 Left 1063149065 10:3320528-3320550 CCAGACTGTGGGGTCCAAGGAGC No data
Right 1063149071 10:3320549-3320571 GCTGTCTGTGGAATTAGGGTGGG No data
1063149065_1063149070 -3 Left 1063149065 10:3320528-3320550 CCAGACTGTGGGGTCCAAGGAGC No data
Right 1063149070 10:3320548-3320570 AGCTGTCTGTGGAATTAGGGTGG No data
1063149065_1063149072 4 Left 1063149065 10:3320528-3320550 CCAGACTGTGGGGTCCAAGGAGC No data
Right 1063149072 10:3320555-3320577 TGTGGAATTAGGGTGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063149065 Original CRISPR GCTCCTTGGACCCCACAGTC TGG (reversed) Intergenic
No off target data available for this crispr