ID: 1063151852

View in Genome Browser
Species Human (GRCh38)
Location 10:3344321-3344343
Sequence CAGCACATGTGGCTGTTACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063151846_1063151852 24 Left 1063151846 10:3344274-3344296 CCGCTGAAAATCGTCTCAGAAGC No data
Right 1063151852 10:3344321-3344343 CAGCACATGTGGCTGTTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063151852 Original CRISPR CAGCACATGTGGCTGTTACC CGG Intergenic
No off target data available for this crispr