ID: 1063159963

View in Genome Browser
Species Human (GRCh38)
Location 10:3412039-3412061
Sequence CAGGAGGAGAGGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063159948_1063159963 28 Left 1063159948 10:3411988-3412010 CCCTTTGTCTTGGTGGCACAGAA No data
Right 1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG No data
1063159953_1063159963 4 Left 1063159953 10:3412012-3412034 CCGTCGGCTGGATGCACCCTGGA No data
Right 1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG No data
1063159949_1063159963 27 Left 1063159949 10:3411989-3412011 CCTTTGTCTTGGTGGCACAGAAG No data
Right 1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063159963 Original CRISPR CAGGAGGAGAGGAGGGAGGT GGG Intergenic
No off target data available for this crispr