ID: 1063160487

View in Genome Browser
Species Human (GRCh38)
Location 10:3414896-3414918
Sequence CCTCGGCTGACACGGGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063160487_1063160492 6 Left 1063160487 10:3414896-3414918 CCTGCGGCCCGTGTCAGCCGAGG No data
Right 1063160492 10:3414925-3414947 GCGACAGAGCTTTTCACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063160487 Original CRISPR CCTCGGCTGACACGGGCCGC AGG (reversed) Intergenic