ID: 1063162717

View in Genome Browser
Species Human (GRCh38)
Location 10:3431268-3431290
Sequence AATGGAGGTGGATCTCGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063162708_1063162717 10 Left 1063162708 10:3431235-3431257 CCTCATGGAGGTGGATCTTGTGG No data
Right 1063162717 10:3431268-3431290 AATGGAGGTGGATCTCGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063162717 Original CRISPR AATGGAGGTGGATCTCGTGG GGG Intergenic
No off target data available for this crispr