ID: 1063165591

View in Genome Browser
Species Human (GRCh38)
Location 10:3459092-3459114
Sequence TCCAGCTGGCCTGCATGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063165589_1063165591 -6 Left 1063165589 10:3459075-3459097 CCTGTGGACATTTGGCTTCCAGC No data
Right 1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG No data
1063165582_1063165591 29 Left 1063165582 10:3459040-3459062 CCCTTCCTGTGGCTTTCTCTGCT No data
Right 1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG No data
1063165587_1063165591 2 Left 1063165587 10:3459067-3459089 CCTGCACTCCTGTGGACATTTGG No data
Right 1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG No data
1063165586_1063165591 6 Left 1063165586 10:3459063-3459085 CCATCCTGCACTCCTGTGGACAT No data
Right 1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG No data
1063165584_1063165591 24 Left 1063165584 10:3459045-3459067 CCTGTGGCTTTCTCTGCTCCATC No data
Right 1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG No data
1063165583_1063165591 28 Left 1063165583 10:3459041-3459063 CCTTCCTGTGGCTTTCTCTGCTC No data
Right 1063165591 10:3459092-3459114 TCCAGCTGGCCTGCATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063165591 Original CRISPR TCCAGCTGGCCTGCATGCTG AGG Intergenic
No off target data available for this crispr