ID: 1063170266

View in Genome Browser
Species Human (GRCh38)
Location 10:3503492-3503514
Sequence TATCAGCAGTGCCAGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063170266_1063170268 4 Left 1063170266 10:3503492-3503514 CCAAATTCCTGGCACTGCTGATA No data
Right 1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063170266 Original CRISPR TATCAGCAGTGCCAGGAATT TGG (reversed) Intergenic
No off target data available for this crispr