ID: 1063170267

View in Genome Browser
Species Human (GRCh38)
Location 10:3503499-3503521
Sequence TTGCACGTATCAGCAGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063170267_1063170272 27 Left 1063170267 10:3503499-3503521 CCTGGCACTGCTGATACGTGCAA No data
Right 1063170272 10:3503549-3503571 CATTTCATCCTACTCAAAAGTGG No data
1063170267_1063170273 28 Left 1063170267 10:3503499-3503521 CCTGGCACTGCTGATACGTGCAA No data
Right 1063170273 10:3503550-3503572 ATTTCATCCTACTCAAAAGTGGG No data
1063170267_1063170268 -3 Left 1063170267 10:3503499-3503521 CCTGGCACTGCTGATACGTGCAA No data
Right 1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063170267 Original CRISPR TTGCACGTATCAGCAGTGCC AGG (reversed) Intergenic
No off target data available for this crispr