ID: 1063170268

View in Genome Browser
Species Human (GRCh38)
Location 10:3503519-3503541
Sequence CAAGCTGCCCACTTTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063170264_1063170268 19 Left 1063170264 10:3503477-3503499 CCACGTTATCGTTTTCCAAATTC No data
Right 1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG No data
1063170267_1063170268 -3 Left 1063170267 10:3503499-3503521 CCTGGCACTGCTGATACGTGCAA No data
Right 1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG No data
1063170266_1063170268 4 Left 1063170266 10:3503492-3503514 CCAAATTCCTGGCACTGCTGATA No data
Right 1063170268 10:3503519-3503541 CAAGCTGCCCACTTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063170268 Original CRISPR CAAGCTGCCCACTTTGAAAA TGG Intergenic
No off target data available for this crispr