ID: 1063171070

View in Genome Browser
Species Human (GRCh38)
Location 10:3510461-3510483
Sequence ACCTGCCTGCTGCAATTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063171070_1063171072 16 Left 1063171070 10:3510461-3510483 CCTTTAAATTGCAGCAGGCAGGT No data
Right 1063171072 10:3510500-3510522 GAAAAAGAAGCCGGCATGAGAGG No data
1063171070_1063171077 27 Left 1063171070 10:3510461-3510483 CCTTTAAATTGCAGCAGGCAGGT No data
Right 1063171077 10:3510511-3510533 CGGCATGAGAGGGACTGGCTGGG No data
1063171070_1063171076 26 Left 1063171070 10:3510461-3510483 CCTTTAAATTGCAGCAGGCAGGT No data
Right 1063171076 10:3510510-3510532 CCGGCATGAGAGGGACTGGCTGG No data
1063171070_1063171073 17 Left 1063171070 10:3510461-3510483 CCTTTAAATTGCAGCAGGCAGGT No data
Right 1063171073 10:3510501-3510523 AAAAAGAAGCCGGCATGAGAGGG No data
1063171070_1063171074 22 Left 1063171070 10:3510461-3510483 CCTTTAAATTGCAGCAGGCAGGT No data
Right 1063171074 10:3510506-3510528 GAAGCCGGCATGAGAGGGACTGG No data
1063171070_1063171071 7 Left 1063171070 10:3510461-3510483 CCTTTAAATTGCAGCAGGCAGGT No data
Right 1063171071 10:3510491-3510513 AGAGAAACAGAAAAAGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063171070 Original CRISPR ACCTGCCTGCTGCAATTTAA AGG (reversed) Intergenic
No off target data available for this crispr