ID: 1063173135

View in Genome Browser
Species Human (GRCh38)
Location 10:3527769-3527791
Sequence TTGCAAAAATGGTGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063173135_1063173139 -4 Left 1063173135 10:3527769-3527791 CCTTTCTCCCACCATTTTTGCAA No data
Right 1063173139 10:3527788-3527810 GCAATAAGATAGTGTCTAGAAGG No data
1063173135_1063173141 -2 Left 1063173135 10:3527769-3527791 CCTTTCTCCCACCATTTTTGCAA No data
Right 1063173141 10:3527790-3527812 AATAAGATAGTGTCTAGAAGGGG No data
1063173135_1063173140 -3 Left 1063173135 10:3527769-3527791 CCTTTCTCCCACCATTTTTGCAA No data
Right 1063173140 10:3527789-3527811 CAATAAGATAGTGTCTAGAAGGG No data
1063173135_1063173142 -1 Left 1063173135 10:3527769-3527791 CCTTTCTCCCACCATTTTTGCAA No data
Right 1063173142 10:3527791-3527813 ATAAGATAGTGTCTAGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063173135 Original CRISPR TTGCAAAAATGGTGGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr