ID: 1063179886

View in Genome Browser
Species Human (GRCh38)
Location 10:3588594-3588616
Sequence CAGGCTCAGAATCCTCTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063179886_1063179889 -8 Left 1063179886 10:3588594-3588616 CCTCCGAGAGGATTCTGAGCCTG No data
Right 1063179889 10:3588609-3588631 TGAGCCTGGAGTTAGAGCAAAGG No data
1063179886_1063179891 11 Left 1063179886 10:3588594-3588616 CCTCCGAGAGGATTCTGAGCCTG No data
Right 1063179891 10:3588628-3588650 AAGGAAATCATCCGTGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063179886 Original CRISPR CAGGCTCAGAATCCTCTCGG AGG (reversed) Intergenic
No off target data available for this crispr