ID: 1063179889

View in Genome Browser
Species Human (GRCh38)
Location 10:3588609-3588631
Sequence TGAGCCTGGAGTTAGAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063179885_1063179889 -1 Left 1063179885 10:3588587-3588609 CCAGACACCTCCGAGAGGATTCT No data
Right 1063179889 10:3588609-3588631 TGAGCCTGGAGTTAGAGCAAAGG No data
1063179883_1063179889 17 Left 1063179883 10:3588569-3588591 CCAGATAAGGAGGGCGGGCCAGA No data
Right 1063179889 10:3588609-3588631 TGAGCCTGGAGTTAGAGCAAAGG No data
1063179886_1063179889 -8 Left 1063179886 10:3588594-3588616 CCTCCGAGAGGATTCTGAGCCTG No data
Right 1063179889 10:3588609-3588631 TGAGCCTGGAGTTAGAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063179889 Original CRISPR TGAGCCTGGAGTTAGAGCAA AGG Intergenic
No off target data available for this crispr