ID: 1063193729 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:3720489-3720511 |
| Sequence | CAATAAATACAGTTTGAGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1063193729_1063193734 | 28 | Left | 1063193729 | 10:3720489-3720511 | CCCACCTCAAACTGTATTTATTG | No data | ||
| Right | 1063193734 | 10:3720540-3720562 | TTCAACACTCTAAGGGAGTGAGG | No data | ||||
| 1063193729_1063193733 | 21 | Left | 1063193729 | 10:3720489-3720511 | CCCACCTCAAACTGTATTTATTG | No data | ||
| Right | 1063193733 | 10:3720533-3720555 | TACTGTATTCAACACTCTAAGGG | No data | ||||
| 1063193729_1063193732 | 20 | Left | 1063193729 | 10:3720489-3720511 | CCCACCTCAAACTGTATTTATTG | No data | ||
| Right | 1063193732 | 10:3720532-3720554 | CTACTGTATTCAACACTCTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1063193729 | Original CRISPR | CAATAAATACAGTTTGAGGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||