ID: 1063193729

View in Genome Browser
Species Human (GRCh38)
Location 10:3720489-3720511
Sequence CAATAAATACAGTTTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063193729_1063193734 28 Left 1063193729 10:3720489-3720511 CCCACCTCAAACTGTATTTATTG No data
Right 1063193734 10:3720540-3720562 TTCAACACTCTAAGGGAGTGAGG No data
1063193729_1063193733 21 Left 1063193729 10:3720489-3720511 CCCACCTCAAACTGTATTTATTG No data
Right 1063193733 10:3720533-3720555 TACTGTATTCAACACTCTAAGGG No data
1063193729_1063193732 20 Left 1063193729 10:3720489-3720511 CCCACCTCAAACTGTATTTATTG No data
Right 1063193732 10:3720532-3720554 CTACTGTATTCAACACTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063193729 Original CRISPR CAATAAATACAGTTTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr