ID: 1063195077

View in Genome Browser
Species Human (GRCh38)
Location 10:3734391-3734413
Sequence CAGGTCTTGCAGAGGATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063195073_1063195077 20 Left 1063195073 10:3734348-3734370 CCAGCTAGGTGCTGTTAGTGCAA No data
Right 1063195077 10:3734391-3734413 CAGGTCTTGCAGAGGATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063195077 Original CRISPR CAGGTCTTGCAGAGGATGGC TGG Intergenic
No off target data available for this crispr