ID: 1063196814

View in Genome Browser
Species Human (GRCh38)
Location 10:3751054-3751076
Sequence CCTGCAGCCGGGAATCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063196814_1063196822 20 Left 1063196814 10:3751054-3751076 CCGCCAGGATTCCCGGCTGCAGG No data
Right 1063196822 10:3751097-3751119 CTTTTCCCTCCATTCTTTCAAGG No data
1063196814_1063196819 -8 Left 1063196814 10:3751054-3751076 CCGCCAGGATTCCCGGCTGCAGG No data
Right 1063196819 10:3751069-3751091 GCTGCAGGACACAGCCCAGCAGG No data
1063196814_1063196823 21 Left 1063196814 10:3751054-3751076 CCGCCAGGATTCCCGGCTGCAGG No data
Right 1063196823 10:3751098-3751120 TTTTCCCTCCATTCTTTCAAGGG No data
1063196814_1063196826 28 Left 1063196814 10:3751054-3751076 CCGCCAGGATTCCCGGCTGCAGG No data
Right 1063196826 10:3751105-3751127 TCCATTCTTTCAAGGGTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063196814 Original CRISPR CCTGCAGCCGGGAATCCTGG CGG (reversed) Intergenic
No off target data available for this crispr