ID: 1063197633

View in Genome Browser
Species Human (GRCh38)
Location 10:3758429-3758451
Sequence GGGGAGATTTTCAGCCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063197633_1063197642 3 Left 1063197633 10:3758429-3758451 CCCGGGTGGCTGAAAATCTCCCC No data
Right 1063197642 10:3758455-3758477 TATGGGCCCAGGGACCTTGATGG No data
1063197633_1063197638 -7 Left 1063197633 10:3758429-3758451 CCCGGGTGGCTGAAAATCTCCCC No data
Right 1063197638 10:3758445-3758467 TCTCCCCAAGTATGGGCCCAGGG No data
1063197633_1063197645 9 Left 1063197633 10:3758429-3758451 CCCGGGTGGCTGAAAATCTCCCC No data
Right 1063197645 10:3758461-3758483 CCCAGGGACCTTGATGGGTCAGG No data
1063197633_1063197637 -8 Left 1063197633 10:3758429-3758451 CCCGGGTGGCTGAAAATCTCCCC No data
Right 1063197637 10:3758444-3758466 ATCTCCCCAAGTATGGGCCCAGG No data
1063197633_1063197643 4 Left 1063197633 10:3758429-3758451 CCCGGGTGGCTGAAAATCTCCCC No data
Right 1063197643 10:3758456-3758478 ATGGGCCCAGGGACCTTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063197633 Original CRISPR GGGGAGATTTTCAGCCACCC GGG (reversed) Intergenic
No off target data available for this crispr