ID: 1063200118

View in Genome Browser
Species Human (GRCh38)
Location 10:3779718-3779740
Sequence CTGAAGACACTGATGAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 290}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063200118_1063200123 1 Left 1063200118 10:3779718-3779740 CCAAGCCTCATCAGTGTCTTCAG 0: 1
1: 0
2: 3
3: 20
4: 290
Right 1063200123 10:3779742-3779764 GACAGGAGATACCAACTGATAGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063200118 Original CRISPR CTGAAGACACTGATGAGGCT TGG (reversed) Intronic
901522725 1:9797703-9797725 CTGAAGGAACAGAGGAGGCTTGG + Intronic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
903201020 1:21738938-21738960 CTGAAAACACTGAAGATACTGGG + Intronic
905167843 1:36093503-36093525 CTGAGTACACCGGTGAGGCTGGG + Exonic
905548003 1:38815563-38815585 CTGAAGTCACAGCTGAGACTTGG + Intergenic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
906212804 1:44021486-44021508 CTGCCGACACTGAAGAGACTTGG + Intronic
906465484 1:46074757-46074779 GGGAAGACCCTGATGAGGCTGGG - Intronic
907230246 1:52991122-52991144 CTAAAGAGAGTGAAGAGGCTAGG - Intronic
908616608 1:65929370-65929392 GGGAAGACACTGATGAAGCTGGG - Intronic
910012370 1:82481212-82481234 CTGAAGTCACAGGTAAGGCTGGG + Intergenic
910549449 1:88459613-88459635 ATGAAGACACTGATGAAGGTGGG - Intergenic
911324728 1:96456772-96456794 CTGAAAACACTGATGAAGCCTGG - Intergenic
912066680 1:105753945-105753967 GGGAAGACCCTGATGAAGCTGGG + Intergenic
912559050 1:110537272-110537294 CTGAACCCACTGATGGGGTTGGG + Intergenic
912864890 1:113248139-113248161 CTGGAGGGAGTGATGAGGCTCGG + Intergenic
915188348 1:154126271-154126293 CTAAGAACACTGAAGAGGCTTGG - Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915978125 1:160403786-160403808 CTTAAGACACCTAAGAGGCTGGG - Intronic
916869356 1:168895730-168895752 GTGAAGAAACTACTGAGGCTTGG + Intergenic
917276214 1:173334653-173334675 GAGAAGACCCTGATGAAGCTGGG + Intergenic
918168580 1:181974263-181974285 CTGAAAAGAATGATTAGGCTGGG + Intergenic
918756073 1:188340456-188340478 GGGAGGACACTGATGAAGCTGGG - Intergenic
920199671 1:204251839-204251861 CTGGAGGCACTGCAGAGGCTGGG + Intronic
920611287 1:207440247-207440269 GTGAAGTCAGGGATGAGGCTTGG - Intergenic
920611379 1:207441190-207441212 GTGAAGTCAGGGATGAGGCTTGG + Intergenic
921719215 1:218451771-218451793 CTGAAGAGACTGAGTTGGCTGGG - Intergenic
922417284 1:225433075-225433097 CTGAAGAAACTGAGGAGGTATGG + Intergenic
922770221 1:228177732-228177754 TTAAAGACACAGAAGAGGCTGGG - Exonic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
924750249 1:246880846-246880868 CAGAAGACAATAATGATGCTAGG + Intronic
924945836 1:248846495-248846517 CTGAAGTTACTGAAGGGGCTGGG - Intronic
1063175621 10:3548426-3548448 CTGAAGATTCTGATAAGGATGGG - Intergenic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1063281277 10:4632025-4632047 CTGAAGAAACAGATGATTCTAGG + Intergenic
1064728400 10:18304249-18304271 ATGAAAACACTGATTAGGCCGGG - Intronic
1067296392 10:44977432-44977454 CTGAGGACACTGCTGGGGCGGGG + Exonic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1067754764 10:48996708-48996730 GTGAGGACCCTGATGAAGCTGGG - Intergenic
1068956258 10:62820541-62820563 CTGTGGACACTCATGAGGGTGGG + Intronic
1069272371 10:66545517-66545539 CTGAAGACACTGATGCATATAGG - Intronic
1069955329 10:72047162-72047184 TTAAATACACTGTTGAGGCTGGG + Intergenic
1070598405 10:77848971-77848993 CAGAAGACCCTGACAAGGCTTGG - Intronic
1070737128 10:78870800-78870822 CTGTAGAGAATGATGAGGCTGGG + Intergenic
1071272030 10:84016744-84016766 CTAACCACACTGCTGAGGCTAGG - Intergenic
1071556656 10:86608680-86608702 GTTAAAACACTGAGGAGGCTCGG - Intergenic
1071771982 10:88739450-88739472 CTGAAGACACTGCTGAGGACAGG + Intronic
1071951129 10:90703532-90703554 GAGAAGACTCTGATGAGGCTGGG - Intergenic
1072839074 10:98750458-98750480 CTGAAGAGACTGAAGGGGATGGG + Intronic
1072869088 10:99097935-99097957 GTCAAGACTCTGATGTGGCTAGG + Intronic
1073568993 10:104560133-104560155 CAGCAAACACAGATGAGGCTGGG - Intergenic
1074297496 10:112204098-112204120 CTGGAGGCACTGATTAGGCACGG - Intronic
1074452104 10:113567716-113567738 CTGTGGACACTGATGAGCCCAGG + Intronic
1074461755 10:113644664-113644686 CTGAGGCTCCTGATGAGGCTTGG + Intronic
1074519898 10:114209713-114209735 CTGAAGACAAAGGGGAGGCTGGG - Intronic
1076428932 10:130388175-130388197 CAGTGGACGCTGATGAGGCTGGG + Intergenic
1078162069 11:8849526-8849548 CTGAAGAGACTGATAAGGCCAGG + Intronic
1078438069 11:11341824-11341846 CTCAAGACCTTGATCAGGCTGGG + Intronic
1079772290 11:24476817-24476839 CTGAAGATACTGATATGGTTTGG - Intergenic
1081811242 11:45915298-45915320 GAGAAGACAATGATGCGGCTAGG - Intronic
1083032245 11:59603812-59603834 CATAGGAAACTGATGAGGCTGGG - Intronic
1083343299 11:61972725-61972747 CTGGAGACATAGATGAGGATTGG + Intergenic
1084147948 11:67275008-67275030 CTGAAGACAAGGATGGGCCTAGG - Intronic
1084514157 11:69626943-69626965 CTGCAAACACTCCTGAGGCTGGG - Intergenic
1085533745 11:77206186-77206208 CTGATGACACTGACGAGGTGAGG + Exonic
1086513347 11:87584766-87584788 CTGAAGAAACTGTTAAGCCTTGG - Intergenic
1086861583 11:91930989-91931011 GGGCAGACCCTGATGAGGCTTGG + Intergenic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1087830139 11:102810788-102810810 CTGAAGACACCTCTGAGACTAGG - Intergenic
1090011895 11:123052623-123052645 TGGAAAACACTGATGGGGCTGGG - Intergenic
1090206581 11:124887608-124887630 CTGAGGAGGCTGATGAGGGTTGG - Intronic
1092513932 12:9187935-9187957 CTGAAAACCCTGATGGGGGTGGG + Intronic
1092593270 12:9971388-9971410 CTGAAGCCACAGATGAGATTTGG + Intronic
1095751562 12:45718225-45718247 CTAAAGACACTGAAGTGGCCAGG + Intergenic
1096108480 12:49013537-49013559 CTGAAGAGCCTTATAAGGCTGGG - Intronic
1096264062 12:50110105-50110127 CTGAGGACACAGATGTTGCTAGG - Exonic
1096741764 12:53698653-53698675 CAGAAGACAGAGATGAGGCCAGG - Intergenic
1099508079 12:83503207-83503229 GGGAGGACCCTGATGAGGCTGGG + Intergenic
1099995381 12:89772278-89772300 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1100322188 12:93506221-93506243 TTGAAGACTCAGAAGAGGCTGGG - Exonic
1101005448 12:100397106-100397128 CTGAAGAGGCTGGTGAAGCTAGG - Intronic
1102085306 12:110132792-110132814 CTGATGAAATTGATGAGACTGGG + Intronic
1103089542 12:118087948-118087970 CGAAAGACCCAGATGAGGCTGGG + Intronic
1103121291 12:118381738-118381760 CTGAAGACAATGAGAAGGTTTGG - Intronic
1103358110 12:120336661-120336683 ATAAAGACACTTCTGAGGCTGGG + Intergenic
1104998584 12:132674424-132674446 CTGAAGACCACCATGAGGCTTGG - Intronic
1105700310 13:22930659-22930681 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1106568071 13:30904392-30904414 CTTAAGACAATGAGGAGCCTTGG - Intergenic
1106619939 13:31363319-31363341 CTGATGACCCTGAAGAGCCTCGG - Intergenic
1107430819 13:40338586-40338608 CTGGAGACTCTGACAAGGCTGGG + Intergenic
1107753829 13:43598004-43598026 CTGCAGAGAGTGATGAGGCAGGG - Intronic
1108903385 13:55440800-55440822 ATGAAGAAACTATTGAGGCTAGG + Intergenic
1109245593 13:59951090-59951112 ATTAAGACACTGATGAGGTTTGG + Intronic
1109402583 13:61854507-61854529 ATGAAGACCCAGATGAGGCATGG + Intergenic
1109997652 13:70150341-70150363 TTGAAGACAGTGATGAGCTTGGG + Intergenic
1111453185 13:88446077-88446099 ATTATGAAACTGATGAGGCTGGG - Intergenic
1111928208 13:94485330-94485352 TTGGAAACACTGATGATGCTCGG - Intergenic
1113510858 13:110853799-110853821 CAGGAGACACTGGGGAGGCTCGG + Intergenic
1114281416 14:21195688-21195710 CTAAACACACTGAACAGGCTCGG + Intergenic
1117517728 14:56519129-56519151 CTGAAGACGATGATGAGTCATGG + Intronic
1117921387 14:60728455-60728477 TTGAAGACAGTGATGAGTGTAGG + Intergenic
1118594163 14:67423152-67423174 CAGAAGACACTGATGATGACAGG - Intergenic
1118624851 14:67649224-67649246 CAAAAGACACTCATGGGGCTAGG + Exonic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119597237 14:75946590-75946612 CTGAACACACAGAAGATGCTTGG - Intronic
1120377787 14:83731178-83731200 TTGGAGACACTGATAAGGCTTGG - Intergenic
1121632092 14:95428837-95428859 CTGAAGCCACTGACGTAGCTGGG + Intronic
1122214959 14:100197082-100197104 ATCAAGAGTCTGATGAGGCTAGG + Intergenic
1122841834 14:104468625-104468647 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1125341247 15:38677692-38677714 ATCAAGACACTGAAGGGGCTGGG - Intergenic
1126798247 15:52277766-52277788 CTGATGACTCTGAAGAAGCTCGG + Intronic
1127786193 15:62357221-62357243 TTGAAGAATCTGATGAGGCCAGG + Intergenic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1130897934 15:88184983-88185005 CTGAAGTCTCAGATGAAGCTAGG - Intronic
1131065808 15:89434365-89434387 CTGAATGCACTGATGAGCTTAGG + Intergenic
1131441546 15:92463463-92463485 CTGAAGACGCTCAGGAGGCAAGG + Intronic
1132385720 15:101398577-101398599 CTGAAAGCACAGAGGAGGCTCGG + Intronic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133255260 16:4512636-4512658 TTGAAGTCATTGATGAGGCAGGG + Exonic
1135625673 16:23992848-23992870 ATGAAGACCCTAATGAAGCTGGG + Intronic
1136361450 16:29782626-29782648 CTGAAGTCACTGGATAGGCTGGG - Exonic
1136593936 16:31233960-31233982 AAGAAGACAATAATGAGGCTGGG + Intergenic
1136683392 16:31980828-31980850 ATGAAGACACTGAGCAGGGTGGG + Intergenic
1136784023 16:32924384-32924406 ATGAAGACACTGAGCAGGGTGGG + Intergenic
1136885759 16:33929422-33929444 ATGAAGACACTGAGCAGGGTGGG - Intergenic
1137231527 16:46571471-46571493 CGGGAGATGCTGATGAGGCTGGG + Intergenic
1140351881 16:74270320-74270342 CTCAAGAGACTGACAAGGCTGGG + Intergenic
1141384182 16:83604121-83604143 GTGAAGAGGCTGATGTGGCTTGG - Intronic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1141618855 16:85225915-85225937 CTGAAGGCTCTGCTGGGGCTGGG + Intergenic
1142160777 16:88556284-88556306 CTAAAGCCACTGATGTGGTTTGG + Intergenic
1203086678 16_KI270728v1_random:1188386-1188408 ATGAAGACACTGAGCAGGGTGGG + Intergenic
1143044545 17:4066506-4066528 CAGAAGTCCCTGATGAGCCTGGG - Exonic
1143903393 17:10191272-10191294 CAGAAGGCAGTGAAGAGGCTGGG + Intronic
1144675612 17:17159505-17159527 CAGAAGACAGTGGTGAGGCAGGG + Intronic
1144684264 17:17215839-17215861 GGGAAGTCACTGATGAGCCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1149236364 17:54594918-54594940 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152945710 17:83196384-83196406 TTGGAGACACAGAGGAGGCTGGG + Intergenic
1153726654 18:7963599-7963621 TTGAATACACTGAGGAGGCCAGG + Intronic
1155666374 18:28314646-28314668 CTGAAGATTCTTATGAGGATTGG - Intergenic
1157510245 18:48266356-48266378 ATGAAGAGACTGAAGAGACTGGG - Intronic
1158662354 18:59399828-59399850 TTGAATACACTGAAGAGACTTGG - Intergenic
1158926405 18:62267634-62267656 CTGAAGACATTGAAGAGATTTGG + Intronic
1159103636 18:63981779-63981801 CTGAAGACACTGAAGAGTGCAGG + Exonic
1159142012 18:64408480-64408502 CTGCAGACACTGATGTTTCTGGG + Intergenic
1160816672 19:1039200-1039222 CTGAAGCCACAGGTGAGTCTGGG + Intergenic
1160916056 19:1497273-1497295 CTGAAGACTCTGTGGAGGCCTGG - Exonic
1162061359 19:8097398-8097420 CTGCAGACATTGATGAGTGTGGG - Exonic
1163520821 19:17790620-17790642 CTGGGGACACAAATGAGGCTGGG + Intergenic
1163580368 19:18135167-18135189 CTGAAGTGACTTGTGAGGCTGGG + Intronic
1166732715 19:45067929-45067951 CTGAGGGCAGTGCTGAGGCTGGG + Intronic
1167067780 19:47199844-47199866 CTGATGACACTGTACAGGCTTGG - Intronic
1168301594 19:55407855-55407877 CTGACGTCACGGTTGAGGCTCGG - Intergenic
926538377 2:14143168-14143190 GGGAAGACTCTGATGAAGCTGGG + Intergenic
926685072 2:15691900-15691922 CTGTGGACACTGCTCAGGCTGGG - Intronic
927417598 2:22894925-22894947 CTGAAGAGTGTCATGAGGCTGGG + Intergenic
928479602 2:31668583-31668605 GTGAAGACACTGAACAGGATGGG + Intergenic
930054843 2:47244052-47244074 CTGGAAACACTGAGCAGGCTTGG - Intergenic
934072046 2:88393298-88393320 CTAAAGACACTCATGATGCCAGG - Intergenic
934121531 2:88845037-88845059 GTGAAGACACTGTTGATGTTAGG + Intergenic
934936243 2:98467540-98467562 CAAAGGACACTGATGATGCTAGG - Intronic
935359527 2:102235729-102235751 CTGAAGACACTGGACAGGCGTGG - Intronic
935622538 2:105142503-105142525 CTGAAGAAGATGAAGAGGCTCGG - Intergenic
937716985 2:125043518-125043540 ATGAAGAAAGTGATAAGGCTGGG + Intergenic
939729434 2:145763639-145763661 ATCAAGTCACTGATGAGACTAGG + Intergenic
940295820 2:152122957-152122979 CTGGAGAGGCTGATGAGGGTGGG + Intronic
942276463 2:174327213-174327235 CCGAAGACCTTGACGAGGCTGGG - Intergenic
943239559 2:185365270-185365292 GGGAGGACACTGATGAAGCTGGG - Intergenic
943395189 2:187324623-187324645 GAGAAGACCCTGATGAAGCTGGG - Intergenic
946466970 2:219920623-219920645 CAGAAGACGCTGATGCTGCTGGG + Intergenic
948129719 2:235591579-235591601 CTGATGTCACTGATGTGGTTTGG + Intronic
1169818052 20:9679071-9679093 CTGAGGAGACTGAGGAGGATGGG - Intronic
1170614560 20:17938310-17938332 CTGAAGGCAGGGAAGAGGCTGGG + Intergenic
1172991929 20:39042981-39043003 CTGAAGGCAATGAGCAGGCTAGG + Intergenic
1173466099 20:43282607-43282629 TTAAAGAAACTGATGAGGCCAGG + Intergenic
1174566723 20:51470008-51470030 CTGACAACACCGAGGAGGCTGGG + Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1176064489 20:63187607-63187629 CTGGAGAGACTGCAGAGGCTGGG - Intergenic
1178101127 21:29269931-29269953 CTGAGGAAACTGAAAAGGCTGGG - Intronic
1178988942 21:37335333-37335355 CTGAAAACACTGATATGGTTTGG - Intergenic
1184322032 22:43749287-43749309 CTGTGGACACTGGTGAGTCTGGG + Intronic
949762530 3:7487332-7487354 CTGAAGAGAATGCTGAGGGTGGG + Intronic
950096301 3:10332769-10332791 AGAAAGACACTGATGAGGCCAGG - Intronic
950526310 3:13526311-13526333 CTGAGGACAGGGATGAGGATGGG + Intergenic
951055277 3:18139997-18140019 CTGAAGACAGTGATGGTACTGGG + Intronic
952258247 3:31714018-31714040 CTGAAGATTCTGAGGAGGCTGGG + Intronic
952881951 3:37990983-37991005 GTGAAAACACTGATGGGGCAGGG + Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
955589382 3:60518191-60518213 TTAAAGAAACTGAAGAGGCTAGG + Intronic
955980358 3:64519071-64519093 CTTAAGATCATGATGAGGCTGGG - Intronic
956873256 3:73438856-73438878 CAGAGGACGCAGATGAGGCTGGG - Intronic
957436791 3:80187913-80187935 CTGAGGACAAGGATGTGGCTAGG - Intergenic
959377745 3:105605848-105605870 GGGAGGACACTGATGAAGCTGGG - Intergenic
961672433 3:128543093-128543115 GTGAAGAAACTTGTGAGGCTAGG + Intergenic
962932585 3:140051686-140051708 CTCAAAACACTATTGAGGCTGGG + Intronic
963125890 3:141815848-141815870 CTGAAGGCTCAGCTGAGGCTGGG - Intronic
963221972 3:142822725-142822747 GTGAAGACACTGAAGACTCTGGG - Intronic
963420517 3:145055640-145055662 CTGCAGAGAATGGTGAGGCTTGG - Intergenic
963823563 3:149926503-149926525 CTAAAAACACAGAAGAGGCTGGG - Intronic
967310203 3:188098864-188098886 CTAAAGAAACAGATGAGGCCGGG + Intergenic
967669072 3:192210876-192210898 CCAAAGACAGTGATGAGGCCAGG + Intronic
967837829 3:193979501-193979523 CTGAAAAGAATGATCAGGCTGGG + Intergenic
967945351 3:194799587-194799609 CTGCTGACACTGATGAGCATGGG + Intergenic
969191730 4:5526715-5526737 CTCAAGACCAAGATGAGGCTGGG + Intronic
969408151 4:7008704-7008726 ATGAAAACAATGATGCGGCTGGG - Intronic
971979642 4:33735534-33735556 GGGAAGACCCTGATGAAGCTGGG - Intergenic
972386686 4:38573596-38573618 CTTAAAACAGTGATTAGGCTGGG - Intergenic
972560417 4:40222935-40222957 CTCAAGTCAGTCATGAGGCTTGG - Intronic
973121368 4:46523916-46523938 GAGAGGACCCTGATGAGGCTGGG - Intergenic
973895101 4:55404308-55404330 CTGAAGAAACTAATATGGCTGGG - Intronic
974530885 4:63106758-63106780 CTGAAGACTCGGATGACTCTTGG - Intergenic
976012585 4:80508851-80508873 CTGAAAACATTGATCAGGCTGGG - Intronic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
978766686 4:112412049-112412071 CAGAAGACACTGAGGACGCGGGG - Intronic
982934911 4:161460905-161460927 CTTAAGCCTCTGAAGAGGCTGGG - Intronic
984793276 4:183633618-183633640 CTGAAGATACTGATGAGTATGGG + Intergenic
986013883 5:3740757-3740779 CTGAGGACACAGAAGAGGTTGGG - Intergenic
986524985 5:8664117-8664139 GGGAGGACCCTGATGAGGCTGGG + Intergenic
986959487 5:13196530-13196552 GGGAGGACCCTGATGAGGCTGGG + Intergenic
987673756 5:21047857-21047879 CTGAACACACTGAAGATCCTAGG + Intergenic
989190003 5:38661329-38661351 CTAAAGACACTTAGGAGGATAGG - Intergenic
990483529 5:56235307-56235329 GAGAAGACCCTGATGAAGCTGGG + Intergenic
992473411 5:77079383-77079405 CTGAAGACAAAGATGAGAATAGG + Intronic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
993412930 5:87594494-87594516 GGGAAGACCCTGATGAAGCTGGG - Intergenic
993423696 5:87735062-87735084 CTGAGAACAATGATGGGGCTGGG - Intergenic
994030588 5:95137319-95137341 TTGACGACAATGCTGAGGCTTGG - Intronic
996825209 5:127675139-127675161 TGGAAGACCCTGATGAAGCTAGG + Intergenic
997415819 5:133727796-133727818 ATGAAGACAGTGAAGAGCCTGGG + Intergenic
997476056 5:134143198-134143220 CTGAAGGCACCGATGAGGAAGGG + Intronic
998451100 5:142235431-142235453 CTGAAGATACTGTTGAGGGGCGG + Intergenic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1000164224 5:158631842-158631864 CTTAAGCCAATGATGAGACTAGG - Intergenic
1000850569 5:166335151-166335173 CTGAAAACACTGAGGTAGCTGGG - Intergenic
1001191157 5:169632560-169632582 ATGGAGACATTGATGGGGCTGGG + Intergenic
1004564341 6:16781518-16781540 CTGATGACACTGATCAGGACTGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1004973471 6:20937559-20937581 GTGAAGAGACTGAGGAGACTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005622830 6:27635703-27635725 AAGAAGACCCTGATGAAGCTGGG - Intergenic
1006576694 6:35051660-35051682 CTGTAGACACCAATGAGGGTTGG - Intronic
1006606783 6:35263126-35263148 CCGAAGAGACTGATGAAGTTTGG - Intronic
1006865360 6:37205327-37205349 CAGAAGACACTGAGGAGGCCAGG + Intergenic
1006980572 6:38144613-38144635 CTAAAAATACTGATGAGCCTTGG - Intronic
1007520352 6:42447198-42447220 CTGAAGAAACAGATGATTCTTGG - Intronic
1009981773 6:70734594-70734616 GTGGGGACTCTGATGAGGCTGGG + Intronic
1010277326 6:73984515-73984537 CTGAACAGAAGGATGAGGCTAGG - Intergenic
1010968480 6:82239030-82239052 CTAAAGAAACTGATGAGGCCAGG - Intronic
1012475558 6:99612838-99612860 ATGGAGACACTGATAAGGATTGG + Intronic
1014471376 6:121819136-121819158 CTGAAGACACACCTGAGACTGGG - Intergenic
1015100128 6:129467966-129467988 CAGAAGATACTGAGTAGGCTGGG - Intronic
1015148420 6:130013492-130013514 CTGAAGACACTGGGGACACTGGG - Intergenic
1015475381 6:133654644-133654666 CAGAGGACCCTGATGAAGCTGGG + Intergenic
1016420338 6:143875959-143875981 GGGAAGACCCTGATGAAGCTGGG - Intronic
1017044503 6:150334497-150334519 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1017318114 6:153055982-153056004 CTAAAAACACTGTTAAGGCTAGG + Intronic
1017925085 6:158904127-158904149 CTGAAGCCACTGCTGTGCCTAGG + Intronic
1018555228 6:165042571-165042593 CAGAAGACAGTCATCAGGCTTGG + Intergenic
1019569000 7:1699993-1700015 AAGAAGACAATGATGAGGCCGGG - Intronic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1024159465 7:46659382-46659404 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1024976649 7:55119760-55119782 TTCAAGACACTGATAAGGATGGG - Intronic
1030545742 7:110892923-110892945 CTGAAGCCAAGGATGAGGGTGGG - Intronic
1032408264 7:131673557-131673579 CTGAAGACCCACATGAGGATGGG - Intergenic
1033607756 7:142939866-142939888 CCCAGGTCACTGATGAGGCTAGG + Intronic
1033959851 7:146901235-146901257 CAGCAGAAACTGTTGAGGCTCGG - Intronic
1036142029 8:6217535-6217557 GAGAAGCCCCTGATGAGGCTGGG + Intergenic
1038947302 8:32375271-32375293 CTAAAAATGCTGATGAGGCTGGG - Intronic
1039272361 8:35897001-35897023 CTGAAGAAAATGAAGAAGCTTGG + Intergenic
1039908742 8:41807626-41807648 AAGAGGACACTGATGAGGCCGGG + Intronic
1040419030 8:47221945-47221967 CTGAAGATGGTGATGATGCTAGG - Intergenic
1040441415 8:47447023-47447045 CTGAAGTCACTGAAGAGGGTTGG - Intronic
1040456677 8:47605167-47605189 CTGAGGAGACAGAGGAGGCTGGG + Intronic
1041985839 8:63921803-63921825 GGGAGGACCCTGATGAGGCTGGG + Intergenic
1043100536 8:76039753-76039775 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1045277925 8:100722960-100722982 GTGAAGACACGGAGGAGGGTCGG - Intergenic
1046352592 8:113034111-113034133 CAGAAGATACTAATGAGACTGGG - Intronic
1046418004 8:113940502-113940524 AGGAAGACCCTGATGAAGCTGGG - Intergenic
1047565092 8:126035207-126035229 GTGAAGACACTGATGAAGCTGGG - Intergenic
1048335697 8:133500531-133500553 CTGAGGGCAGTGATGAGGGTGGG + Intronic
1048654705 8:136522905-136522927 AGGAAGACCCTGATGAAGCTGGG - Intergenic
1051342648 9:16126133-16126155 GTGAAGTCACTGAAGAGGGTTGG + Intergenic
1052718434 9:32146438-32146460 GGGAAGACCCTGATGAAGCTGGG + Intergenic
1052789331 9:32859952-32859974 GGGAGGACCCTGATGAGGCTGGG - Intergenic
1057774366 9:97994254-97994276 ATGAAGACACTCTTTAGGCTGGG - Intronic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1059816151 9:117918068-117918090 CTCACCACGCTGATGAGGCTGGG + Intergenic
1060491465 9:124088293-124088315 CAGAAGGCACAGATGAGGCCAGG - Intergenic
1062505741 9:136875000-136875022 ATAAAGAAACTGATGGGGCTGGG + Intronic
1062661913 9:137641020-137641042 TGGAAGACACTGATGAGGAACGG - Intronic
1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG + Intronic
1187388317 X:18868702-18868724 TAGAAAACACTAATGAGGCTGGG - Intergenic
1190317452 X:49160400-49160422 GTGAAGATACTGAACAGGCTGGG + Intergenic
1191150878 X:57220223-57220245 GAGAAGACAATGAGGAGGCTTGG - Intergenic
1191174148 X:57482018-57482040 CTGAAAGCACTGAGGAGGCTGGG - Intronic
1192148878 X:68699633-68699655 CAGAGGACAGTGATGAGGCTGGG - Intronic
1193446892 X:81616562-81616584 GGGAGGACACTGATGAAGCTGGG + Intergenic
1193531618 X:82661096-82661118 CAGAAAATCCTGATGAGGCTGGG - Intergenic
1193634449 X:83931027-83931049 CTGAAGAGACTGATATGGTTTGG + Intergenic
1193832592 X:86307434-86307456 GAGAAGACCCTGATGAAGCTGGG + Intronic
1194342961 X:92728417-92728439 GAGAGGACCCTGATGAGGCTGGG + Intergenic
1195469641 X:105218341-105218363 CTGAGGCCACTGCTGAGGCTTGG - Intronic
1197001946 X:121450363-121450385 GGGAGGACACTGATGAAGCTGGG + Intergenic
1197134503 X:123045475-123045497 CTGCAGACACTGATATGGTTTGG + Intergenic
1197942113 X:131801428-131801450 CTGAAGGCACTGTGGAGGCTGGG + Intergenic
1198709059 X:139481540-139481562 CTGAATACAGTTCTGAGGCTTGG + Intergenic
1199157454 X:144567401-144567423 CTGAAGACAGTGAGCAGGATGGG - Intergenic
1199927375 X:152481113-152481135 CAGAAGACACACCTGAGGCTCGG + Intergenic
1200651322 Y:5845083-5845105 GAGAGGACCCTGATGAGGCTGGG + Intergenic