ID: 1063204414

View in Genome Browser
Species Human (GRCh38)
Location 10:3817187-3817209
Sequence CCCCAAGTGGACAATTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063204414_1063204423 30 Left 1063204414 10:3817187-3817209 CCATGGAAATTGTCCACTTGGGG No data
Right 1063204423 10:3817240-3817262 ATGACACATGTGTCAGGTTGGGG No data
1063204414_1063204422 29 Left 1063204414 10:3817187-3817209 CCATGGAAATTGTCCACTTGGGG No data
Right 1063204422 10:3817239-3817261 TATGACACATGTGTCAGGTTGGG No data
1063204414_1063204420 24 Left 1063204414 10:3817187-3817209 CCATGGAAATTGTCCACTTGGGG No data
Right 1063204420 10:3817234-3817256 CTTGATATGACACATGTGTCAGG No data
1063204414_1063204421 28 Left 1063204414 10:3817187-3817209 CCATGGAAATTGTCCACTTGGGG No data
Right 1063204421 10:3817238-3817260 ATATGACACATGTGTCAGGTTGG No data
1063204414_1063204419 -7 Left 1063204414 10:3817187-3817209 CCATGGAAATTGTCCACTTGGGG No data
Right 1063204419 10:3817203-3817225 CTTGGGGCTGTTGGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063204414 Original CRISPR CCCCAAGTGGACAATTTCCA TGG (reversed) Intergenic
No off target data available for this crispr