ID: 1063204418

View in Genome Browser
Species Human (GRCh38)
Location 10:3817200-3817222
Sequence GCCAGTCCAACAGCCCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063204418_1063204421 15 Left 1063204418 10:3817200-3817222 CCACTTGGGGCTGTTGGACTGGC No data
Right 1063204421 10:3817238-3817260 ATATGACACATGTGTCAGGTTGG No data
1063204418_1063204425 19 Left 1063204418 10:3817200-3817222 CCACTTGGGGCTGTTGGACTGGC No data
Right 1063204425 10:3817242-3817264 GACACATGTGTCAGGTTGGGGGG No data
1063204418_1063204422 16 Left 1063204418 10:3817200-3817222 CCACTTGGGGCTGTTGGACTGGC No data
Right 1063204422 10:3817239-3817261 TATGACACATGTGTCAGGTTGGG No data
1063204418_1063204423 17 Left 1063204418 10:3817200-3817222 CCACTTGGGGCTGTTGGACTGGC No data
Right 1063204423 10:3817240-3817262 ATGACACATGTGTCAGGTTGGGG No data
1063204418_1063204420 11 Left 1063204418 10:3817200-3817222 CCACTTGGGGCTGTTGGACTGGC No data
Right 1063204420 10:3817234-3817256 CTTGATATGACACATGTGTCAGG No data
1063204418_1063204424 18 Left 1063204418 10:3817200-3817222 CCACTTGGGGCTGTTGGACTGGC No data
Right 1063204424 10:3817241-3817263 TGACACATGTGTCAGGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063204418 Original CRISPR GCCAGTCCAACAGCCCCAAG TGG (reversed) Intergenic
No off target data available for this crispr