ID: 1063204419

View in Genome Browser
Species Human (GRCh38)
Location 10:3817203-3817225
Sequence CTTGGGGCTGTTGGACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063204409_1063204419 28 Left 1063204409 10:3817152-3817174 CCGGCACTGAAATAATCAGAGCC No data
Right 1063204419 10:3817203-3817225 CTTGGGGCTGTTGGACTGGCAGG No data
1063204414_1063204419 -7 Left 1063204414 10:3817187-3817209 CCATGGAAATTGTCCACTTGGGG No data
Right 1063204419 10:3817203-3817225 CTTGGGGCTGTTGGACTGGCAGG No data
1063204411_1063204419 7 Left 1063204411 10:3817173-3817195 CCTGTTGTTATGAGCCATGGAAA No data
Right 1063204419 10:3817203-3817225 CTTGGGGCTGTTGGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063204419 Original CRISPR CTTGGGGCTGTTGGACTGGC AGG Intergenic
No off target data available for this crispr