ID: 1063204422

View in Genome Browser
Species Human (GRCh38)
Location 10:3817239-3817261
Sequence TATGACACATGTGTCAGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063204414_1063204422 29 Left 1063204414 10:3817187-3817209 CCATGGAAATTGTCCACTTGGGG No data
Right 1063204422 10:3817239-3817261 TATGACACATGTGTCAGGTTGGG No data
1063204418_1063204422 16 Left 1063204418 10:3817200-3817222 CCACTTGGGGCTGTTGGACTGGC No data
Right 1063204422 10:3817239-3817261 TATGACACATGTGTCAGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063204422 Original CRISPR TATGACACATGTGTCAGGTT GGG Intergenic
No off target data available for this crispr