ID: 1063216034

View in Genome Browser
Species Human (GRCh38)
Location 10:3926427-3926449
Sequence ACTGTTGGTGTTGTTCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063216030_1063216034 20 Left 1063216030 10:3926384-3926406 CCAAGCTCTTTCAAATCTCAGAT No data
Right 1063216034 10:3926427-3926449 ACTGTTGGTGTTGTTCTTTGTGG No data
1063216029_1063216034 21 Left 1063216029 10:3926383-3926405 CCCAAGCTCTTTCAAATCTCAGA No data
Right 1063216034 10:3926427-3926449 ACTGTTGGTGTTGTTCTTTGTGG No data
1063216032_1063216034 -7 Left 1063216032 10:3926411-3926433 CCACTAAGAGGCTGTTACTGTTG No data
Right 1063216034 10:3926427-3926449 ACTGTTGGTGTTGTTCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063216034 Original CRISPR ACTGTTGGTGTTGTTCTTTG TGG Intergenic
No off target data available for this crispr