ID: 1063216113

View in Genome Browser
Species Human (GRCh38)
Location 10:3927084-3927106
Sequence CACCTGGCAAAGCTGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063216108_1063216113 19 Left 1063216108 10:3927042-3927064 CCGTCTTTGCTTTTTAAAATTCT No data
Right 1063216113 10:3927084-3927106 CACCTGGCAAAGCTGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063216113 Original CRISPR CACCTGGCAAAGCTGCAGCT GGG Intergenic
No off target data available for this crispr