ID: 1063217334

View in Genome Browser
Species Human (GRCh38)
Location 10:3936673-3936695
Sequence CAGGCCCACCTCCAGCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063217334_1063217344 -1 Left 1063217334 10:3936673-3936695 CCCCAATGCTGGAGGTGGGCCTG No data
Right 1063217344 10:3936695-3936717 GGTGGGAGGTGACAGGGCCATGG No data
1063217334_1063217345 2 Left 1063217334 10:3936673-3936695 CCCCAATGCTGGAGGTGGGCCTG No data
Right 1063217345 10:3936698-3936720 GGGAGGTGACAGGGCCATGGAGG No data
1063217334_1063217342 -7 Left 1063217334 10:3936673-3936695 CCCCAATGCTGGAGGTGGGCCTG No data
Right 1063217342 10:3936689-3936711 GGGCCTGGTGGGAGGTGACAGGG No data
1063217334_1063217341 -8 Left 1063217334 10:3936673-3936695 CCCCAATGCTGGAGGTGGGCCTG No data
Right 1063217341 10:3936688-3936710 TGGGCCTGGTGGGAGGTGACAGG 0: 13
1: 486
2: 2121
3: 4446
4: 5952
1063217334_1063217346 5 Left 1063217334 10:3936673-3936695 CCCCAATGCTGGAGGTGGGCCTG No data
Right 1063217346 10:3936701-3936723 AGGTGACAGGGCCATGGAGGTGG No data
1063217334_1063217347 15 Left 1063217334 10:3936673-3936695 CCCCAATGCTGGAGGTGGGCCTG No data
Right 1063217347 10:3936711-3936733 GCCATGGAGGTGGCTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063217334 Original CRISPR CAGGCCCACCTCCAGCATTG GGG (reversed) Intergenic
No off target data available for this crispr