ID: 1063217823

View in Genome Browser
Species Human (GRCh38)
Location 10:3939716-3939738
Sequence CTGGTTGGACAGATGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063217823_1063217828 -10 Left 1063217823 10:3939716-3939738 CCTTTTCCCATCTGTCCAACCAG No data
Right 1063217828 10:3939729-3939751 GTCCAACCAGGGAGTCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063217823 Original CRISPR CTGGTTGGACAGATGGGAAA AGG (reversed) Intergenic
No off target data available for this crispr