ID: 1063225179

View in Genome Browser
Species Human (GRCh38)
Location 10:4008847-4008869
Sequence CTGTGTTAGTTAAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063225179_1063225181 -3 Left 1063225179 10:4008847-4008869 CCATCTTCCTTTAACTAACACAG No data
Right 1063225181 10:4008867-4008889 CAGCTATACAGTCAGTCATCTGG No data
1063225179_1063225182 -2 Left 1063225179 10:4008847-4008869 CCATCTTCCTTTAACTAACACAG No data
Right 1063225182 10:4008868-4008890 AGCTATACAGTCAGTCATCTGGG No data
1063225179_1063225183 26 Left 1063225179 10:4008847-4008869 CCATCTTCCTTTAACTAACACAG No data
Right 1063225183 10:4008896-4008918 AACATAAGCTATCTAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063225179 Original CRISPR CTGTGTTAGTTAAAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr