ID: 1063228252

View in Genome Browser
Species Human (GRCh38)
Location 10:4036448-4036470
Sequence CTGATGAAGTTCACTTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063228252_1063228253 14 Left 1063228252 10:4036448-4036470 CCAAACAAAGTGAACTTCATCAG No data
Right 1063228253 10:4036485-4036507 AGAAAGAAAATCATTTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063228252 Original CRISPR CTGATGAAGTTCACTTTGTT TGG (reversed) Intergenic
No off target data available for this crispr