ID: 1063236235

View in Genome Browser
Species Human (GRCh38)
Location 10:4119296-4119318
Sequence CCTTAGGAGGAAGCGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063236235_1063236246 14 Left 1063236235 10:4119296-4119318 CCATCCATCGCTTCCTCCTAAGG No data
Right 1063236246 10:4119333-4119355 AGTGCGAGGCTGCCGAGACAAGG No data
1063236235_1063236241 0 Left 1063236235 10:4119296-4119318 CCATCCATCGCTTCCTCCTAAGG No data
Right 1063236241 10:4119319-4119341 CCACCCCTGTAACCAGTGCGAGG No data
1063236235_1063236248 30 Left 1063236235 10:4119296-4119318 CCATCCATCGCTTCCTCCTAAGG No data
Right 1063236248 10:4119349-4119371 GACAAGGTTCATTCCATCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063236235 Original CRISPR CCTTAGGAGGAAGCGATGGA TGG (reversed) Intergenic
No off target data available for this crispr