ID: 1063236241

View in Genome Browser
Species Human (GRCh38)
Location 10:4119319-4119341
Sequence CCACCCCTGTAACCAGTGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063236235_1063236241 0 Left 1063236235 10:4119296-4119318 CCATCCATCGCTTCCTCCTAAGG No data
Right 1063236241 10:4119319-4119341 CCACCCCTGTAACCAGTGCGAGG No data
1063236237_1063236241 -4 Left 1063236237 10:4119300-4119322 CCATCGCTTCCTCCTAAGGCCAC No data
Right 1063236241 10:4119319-4119341 CCACCCCTGTAACCAGTGCGAGG No data
1063236234_1063236241 1 Left 1063236234 10:4119295-4119317 CCCATCCATCGCTTCCTCCTAAG No data
Right 1063236241 10:4119319-4119341 CCACCCCTGTAACCAGTGCGAGG No data
1063236232_1063236241 3 Left 1063236232 10:4119293-4119315 CCCCCATCCATCGCTTCCTCCTA No data
Right 1063236241 10:4119319-4119341 CCACCCCTGTAACCAGTGCGAGG No data
1063236233_1063236241 2 Left 1063236233 10:4119294-4119316 CCCCATCCATCGCTTCCTCCTAA No data
Right 1063236241 10:4119319-4119341 CCACCCCTGTAACCAGTGCGAGG No data
1063236231_1063236241 16 Left 1063236231 10:4119280-4119302 CCTCTGGACATTGCCCCCATCCA No data
Right 1063236241 10:4119319-4119341 CCACCCCTGTAACCAGTGCGAGG No data
1063236230_1063236241 29 Left 1063236230 10:4119267-4119289 CCAGAAGGATTCACCTCTGGACA No data
Right 1063236241 10:4119319-4119341 CCACCCCTGTAACCAGTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063236241 Original CRISPR CCACCCCTGTAACCAGTGCG AGG Intergenic
No off target data available for this crispr